EMAIL THIS PAGE TO A FRIEND

ELK3

ELK3, ETS-domain protein (SRF accessory protein 2)

118 Gene Product Result for
Synonyms: ERP NET SAP2
UniProtKB ID: P41970, B2R6S6, Q6FG57, Q6GU29, Q9UD17
Gene ID:
Human(2004) Summary: The protein encoded by this gene is a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. [provided by RefSeq, Jul 2008]
Mouse(13713) ELK3, member of ETS oncogene family
Rat(362871) ELK3, member of ETS oncogene family
Zebrafish(557074) ELK3, ETS-domain protein
cow(541125) ELK3, ETS-domain protein (SRF accessory protein 2)
Horse(100052318) ELK3, ETS-domain protein (SRF accessory protein 2)
domestic cat(101084208) ELK3, ETS-domain protein (SRF accessory protein 2)
dog(482613) ELK3, ETS-domain protein (SRF accessory protein 2)
chicken(417919) ELK3, ETS-domain protein (SRF accessory protein 2)
sheep(101122180) ELK3, ETS-domain protein (SRF accessory protein 2)
naked mole-rat(101697446) ELK3, ETS-domain protein (SRF accessory protein 2)
domestic guinea pig(100717769) ELK3, ETS-domain protein (SRF accessory protein 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100676 Anti-ELK3 (ab1) antibody produced in rabbit affinity isolated antibody bovine, canine, guinea pig, mouse, rabbit, human, rat, horse
western blot pricing
SAB2100677 Anti-ELK3 (ab2) antibody produced in rabbit affinity isolated antibody bovine, mouse, guinea pig, rat, canine, human, rabbit, horse
western blot pricing
HPA001600 Anti-ELK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106441 Anti-ELK3 antibody produced in rabbit affinity isolated antibody human, mouse, horse, rabbit, guinea pig
ELISA, western blot pricing
SAB1410332 Anti-ELK3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4500755 Anti-ELK3, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence pricing
SAB4504179 Anti-phospho-Elk3 (pSer357) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100371 Monoclonal Anti-ELK3 antibody produced in mouse clone ELK3-A315, culture supernatant human
western blot pricing
SAB1402181 Monoclonal Anti-ELK3 antibody produced in mouse clone 3A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005230 Rosetta Predictions human pricing
NM_001108743 Rosetta Predictions rat pricing
NM_013508 Rosetta Predictions mouse pricing
NM_205536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046773 predicted 1746
2 SASI_Hs01_00046774 predicted 942
3 SASI_Hs01_00046776 predicted 1625
4 SASI_Hs01_00046777 predicted 1586
5 SASI_Hs01_00046779 predicted 1790
6 SASI_Hs01_00046781 predicted 1275
7 SASI_Hs02_00339227 predicted 1104
8 SASI_Hs02_00339228 predicted 429
9 SASI_Hs02_00339229 predicted 1511
10 SASI_Hs02_00339230 predicted 1508
11 SASI_Hs01_00046772 predicted 472
12 SASI_Hs01_00046775 predicted 827
13 SASI_Hs01_00046778 predicted 818
14 SASI_Hs01_00046780 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241645 predicted 669
2 SASI_Rn02_00241646 predicted 983
3 SASI_Rn02_00241647 predicted 551
4 SASI_Rn02_00241648 predicted 420
5 SASI_Rn02_00241649 predicted 253
6 SASI_Rn02_00241650 predicted 544
7 SASI_Rn02_00241651 predicted 692
8 SASI_Rn02_00241652 predicted 539
9 SASI_Rn02_00241653 predicted 758
10 SASI_Rn02_00241654 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045582 predicted 592
2 SASI_Mm01_00045583 predicted 1068
3 SASI_Mm02_00322173 predicted 828
4 SASI_Mm01_00045584 predicted 603
5 SASI_Mm01_00045585 predicted 958
6 SASI_Mm02_00322174 predicted 876
7 SASI_Mm01_00045589 predicted 949
8 SASI_Mm01_00045591 predicted 945
9 SASI_Mm02_00322175 predicted 1094
10 SASI_Mm02_00322176 predicted 1395
11 SASI_Mm01_00045586 predicted 946
12 SASI_Mm01_00045587 predicted 1967
13 SASI_Mm01_00045588 predicted 470
14 SASI_Mm01_00045590 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195385 predicted 343
2 SASI_Mm01_00195386 predicted 823
3 SASI_Mm01_00195387 predicted 364
4 SASI_Mm01_00195388 predicted 708
5 SASI_Mm01_00195389 predicted 813
6 SASI_Mm01_00195390 predicted 331
7 SASI_Mm01_00195391 predicted 706
8 SASI_Mm01_00195392 predicted 227
9 SASI_Mm01_00195393 predicted 701
10 SASI_Mm01_00195394 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005230
VALIDATED
ELK3 MISSION shRNA Bacterial Glycerol Stock
ELK3, ETS-domain protein (SRF accessory protein 2)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-1476s21c1
Sequence:CCGGGCTTTCTTCAAACTCTCAGAACTCGAGTTCTGAGAGTTTGAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-326s21c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005230.2-707s21c1
Sequence:CCGGACTCGTCCTTCACCATTAATTCTCGAGAATTAATGGTGAAGGACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005230.2-1513s21c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005230.2-1513s1c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005230.2-326s1c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005230.2-945s1c1
Sequence:CCGGCTCCTCTTTAATGTTGCCAAACTCGAGTTTGGCAACATTAAAGAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005230
VALIDATED
ELK3 MISSION shRNA shRNA Plasmid DNA
ELK3, ETS-domain protein (SRF accessory protein 2)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-1476s21c1
Sequence:CCGGGCTTTCTTCAAACTCTCAGAACTCGAGTTCTGAGAGTTTGAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-326s21c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005230.2-707s21c1
Sequence:CCGGACTCGTCCTTCACCATTAATTCTCGAGAATTAATGGTGAAGGACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005230.2-1513s21c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005230.2-1513s1c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005230.2-326s1c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005230.2-945s1c1
Sequence:CCGGCTCCTCTTTAATGTTGCCAAACTCGAGTTTGGCAACATTAAAGAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005230
VALIDATED
ELK3 MISSION shRNA Lentiviral Transduction Particles
ELK3, ETS-domain protein (SRF accessory protein 2)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-1476s21c1
Sequence:CCGGGCTTTCTTCAAACTCTCAGAACTCGAGTTCTGAGAGTTTGAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005230.2-326s21c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005230.2-707s21c1
Sequence:CCGGACTCGTCCTTCACCATTAATTCTCGAGAATTAATGGTGAAGGACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005230.2-1513s21c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005230.2-1513s1c1
Sequence:CCGGGCCACAATTAAGGACTCATTACTCGAGTAATGAGTCCTTAATTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005230.2-326s1c1
Sequence:CCGGTGGATCAGAAACATGAGCATTCTCGAGAATGCTCATGTTTCTGATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005230.2-945s1c1
Sequence:CCGGCTCCTCTTTAATGTTGCCAAACTCGAGTTTGGCAACATTAAAGAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013508
VALIDATED
ELK3 MISSION shRNA Bacterial Glycerol Stock
ELK3, ETS-domain protein (SRF accessory protein 2)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-957s21c1
Sequence:CCGGATCAGGTTTGTGACCAATAAACTCGAGTTTATTGGTCACAAACCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-591s21c1
Sequence:CCGGAGAGCGCTGAGATACTATTACCTCGAGGTAATAGTATCTCAGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-1073s21c1
Sequence:CCGGAGCCAAGATCTCCTCTTTAATCTCGAGATTAAAGAGGAGATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-660s21c1
Sequence:CCGGTTCGTCTCTTTCCCGGATATCCTCGAGGATATCCGGGAAAGAGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013508.2-2655s21c1
Sequence:CCGGTGTTGAGGCTGTGGGTATAAACTCGAGTTTATACCCACAGCCTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-480s1c1
Sequence:CCGGGCTGAGATACTATTACGACAACTCGAGTTGTCGTAATAGTATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-360s1c1
Sequence:CCGGCCTCATCTGCTGGACATCGAACTCGAGTTCGATGTCCAGCAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-1052s1c1
Sequence:CCGGCCCTCCCTTCTGAACACAGAACTCGAGTTCTGTGTTCAGAAGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-1180s1c1
Sequence:CCGGCCCAAAGGCTTGGAAATCTCTCTCGAGAGAGATTTCCAAGCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-945s1c1
Sequence:CCGGCTCATCTGTCTCAGCCAAGATCTCGAGATCTTGGCTGAGACAGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013508
VALIDATED
ELK3 MISSION shRNA shRNA Plasmid DNA
ELK3, ETS-domain protein (SRF accessory protein 2)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-957s21c1
Sequence:CCGGATCAGGTTTGTGACCAATAAACTCGAGTTTATTGGTCACAAACCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-591s21c1
Sequence:CCGGAGAGCGCTGAGATACTATTACCTCGAGGTAATAGTATCTCAGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-1073s21c1
Sequence:CCGGAGCCAAGATCTCCTCTTTAATCTCGAGATTAAAGAGGAGATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-660s21c1
Sequence:CCGGTTCGTCTCTTTCCCGGATATCCTCGAGGATATCCGGGAAAGAGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013508.2-2655s21c1
Sequence:CCGGTGTTGAGGCTGTGGGTATAAACTCGAGTTTATACCCACAGCCTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-480s1c1
Sequence:CCGGGCTGAGATACTATTACGACAACTCGAGTTGTCGTAATAGTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-360s1c1
Sequence:CCGGCCTCATCTGCTGGACATCGAACTCGAGTTCGATGTCCAGCAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-1052s1c1
Sequence:CCGGCCCTCCCTTCTGAACACAGAACTCGAGTTCTGTGTTCAGAAGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-1180s1c1
Sequence:CCGGCCCAAAGGCTTGGAAATCTCTCTCGAGAGAGATTTCCAAGCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-945s1c1
Sequence:CCGGCTCATCTGTCTCAGCCAAGATCTCGAGATCTTGGCTGAGACAGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013508
VALIDATED
ELK3 MISSION shRNA Lentiviral Transduction Particles
ELK3, ETS-domain protein (SRF accessory protein 2)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-957s21c1
Sequence:CCGGATCAGGTTTGTGACCAATAAACTCGAGTTTATTGGTCACAAACCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-591s21c1
Sequence:CCGGAGAGCGCTGAGATACTATTACCTCGAGGTAATAGTATCTCAGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-1073s21c1
Sequence:CCGGAGCCAAGATCTCCTCTTTAATCTCGAGATTAAAGAGGAGATCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013508.2-660s21c1
Sequence:CCGGTTCGTCTCTTTCCCGGATATCCTCGAGGATATCCGGGAAAGAGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013508.2-2655s21c1
Sequence:CCGGTGTTGAGGCTGTGGGTATAAACTCGAGTTTATACCCACAGCCTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-480s1c1
Sequence:CCGGGCTGAGATACTATTACGACAACTCGAGTTGTCGTAATAGTATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-360s1c1
Sequence:CCGGCCTCATCTGCTGGACATCGAACTCGAGTTCGATGTCCAGCAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-1052s1c1
Sequence:CCGGCCCTCCCTTCTGAACACAGAACTCGAGTTCTGTGTTCAGAAGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013508.1-1180s1c1
Sequence:CCGGCCCAAAGGCTTGGAAATCTCTCTCGAGAGAGATTTCCAAGCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013508.1-945s1c1
Sequence:CCGGCTCATCTGTCTCAGCCAAGATCTCGAGATCTTGGCTGAGACAGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)