EMAIL THIS PAGE TO A FRIEND

ELK4

ELK4, ETS-domain protein (SRF accessory protein 1)

Synonyms: SAP1
UniProtKB ID: P28324, P28323, Q6GSJ2
Gene ID:
Human(2005) Summary: This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum reponse element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is phosphorylated by the kinases, MAPK1 and MAPK8. Several transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(13714) ELK4, member of ETS oncogene family
Rat(304786) ELK4, ETS-domain protein (SRF accessory protein 1)
domestic guinea pig(100719249) ELK4, ETS-domain protein (SRF accessory protein 1)
naked mole-rat(101705607) ELK4, ETS-domain protein (SRF accessory protein 1)
sheep(101114794) ELK4, ETS-domain protein (SRF accessory protein 1)
Zebrafish(30093) ELK4, ETS-domain protein
cow(540309) ELK4, ETS-domain protein (SRF accessory protein 1)
Horse(100050315) ELK4, ETS-domain protein (SRF accessory protein 1)
domestic cat(101086621) ELK4, ETS-domain protein (SRF accessory protein 1)
dog(488574) ELK4, ETS-domain protein (SRF accessory protein 1)
chicken(419832) ELK4, ETS-domain protein (SRF accessory protein 1)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001973 Rosetta Predictions human pricing
NM_021795 Rosetta Predictions human pricing
NM_001107173 Rosetta Predictions rat pricing
NM_007923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041167 predicted 1306
2 SASI_Hs01_00041168 predicted 1862
3 SASI_Hs01_00041169 predicted 1801
4 SASI_Hs01_00041170 predicted 1322
5 SASI_Hs01_00041173 predicted 1256
6 SASI_Hs01_00041174 predicted 1493
7 SASI_Hs01_00041175 predicted 1561
8 SASI_Hs01_00041176 predicted 1321
9 SASI_Hs02_00332943 predicted 1607
10 SASI_Hs02_00332944 predicted 1318
11 SASI_Hs01_00041171 predicted 1665
12 SASI_Hs01_00041172 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065290 predicted 1309
2 SASI_Hs01_00065291 predicted 1863
3 SASI_Hs01_00065292 predicted 1803
4 SASI_Hs01_00065293 predicted 1321
5 SASI_Hs01_00065296 predicted 1256
6 SASI_Hs01_00065297 predicted 1501
7 SASI_Hs01_00065298 predicted 1567
8 SASI_Hs01_00065299 predicted 1326
9 SASI_Hs02_00355096 predicted 1609
10 SASI_Hs02_00355097 predicted 1312
11 SASI_Hs01_00065294 predicted 1675
12 SASI_Hs01_00065295 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226225 predicted 1166
2 SASI_Rn02_00226226 predicted 730
3 SASI_Rn02_00226227 predicted 586
4 SASI_Rn02_00226228 predicted 709
5 SASI_Rn02_00226229 predicted 585
6 SASI_Rn02_00226230 predicted 1158
7 SASI_Rn02_00226231 predicted 973
8 SASI_Rn02_00226232 predicted 743
9 SASI_Rn02_00226233 predicted 301
10 SASI_Rn02_00226234 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127969 predicted 390
2 SASI_Mm01_00127971 predicted 1210
3 SASI_Mm01_00127970 predicted 1024
4 SASI_Mm02_00312749 predicted 1203
5 SASI_Mm01_00127972 predicted 760
6 SASI_Mm02_00312750 predicted 1066
7 SASI_Mm01_00127973 predicted 1293
8 SASI_Mm01_00127974 predicted 685
9 SASI_Mm01_00127975 predicted 1388
10 SASI_Mm01_00127976 predicted 1152
11 SASI_Mm01_00127977 predicted 436
12 SASI_Mm01_00127978 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001973
ELK4 MISSION shRNA Bacterial Glycerol Stock
ELK4, ETS-domain protein (SRF accessory protein 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001973.2-2590s1c1
Sequence:CCGGGACATTCAACATGATTGCATTCTCGAGAATGCAATCATGTTGAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2076s1c1
Sequence:CCGGCCAGACATCGACACAGACATTCTCGAGAATGTCTGTGTCGATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1882s1c1
Sequence:CCGGGCCCAAGTATTTCTCCATCTTCTCGAGAAGATGGAGAAATACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2301s1c1
Sequence:CCGGGCTTCTCTTACACCAGCATTTCTCGAGAAATGCTGGTGTAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1435s1c1
Sequence:CCGGCCCTCAGATACTATTATGTAACTCGAGTTACATAATAGTATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2635s21c1
Sequence:CCGGCAATGCTGATAATAGACTATTCTCGAGAATAGTCTATTATCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1318s21c1
Sequence:CCGGTGATCTGTTGGACCTCTAATGCTCGAGCATTAGAGGTCCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2707s21c1
Sequence:CCGGTAGGACTCAAGTTGGACTATACTCGAGTATAGTCCAACTTGAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1803s21c1
Sequence:CCGGACACCATCTGTCATCAAATTTCTCGAGAAATTTGATGACAGATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001973
ELK4 MISSION shRNA shRNA Plasmid DNA
ELK4, ETS-domain protein (SRF accessory protein 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001973.2-2590s1c1
Sequence:CCGGGACATTCAACATGATTGCATTCTCGAGAATGCAATCATGTTGAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2076s1c1
Sequence:CCGGCCAGACATCGACACAGACATTCTCGAGAATGTCTGTGTCGATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1882s1c1
Sequence:CCGGGCCCAAGTATTTCTCCATCTTCTCGAGAAGATGGAGAAATACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2301s1c1
Sequence:CCGGGCTTCTCTTACACCAGCATTTCTCGAGAAATGCTGGTGTAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1435s1c1
Sequence:CCGGCCCTCAGATACTATTATGTAACTCGAGTTACATAATAGTATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2635s21c1
Sequence:CCGGCAATGCTGATAATAGACTATTCTCGAGAATAGTCTATTATCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1318s21c1
Sequence:CCGGTGATCTGTTGGACCTCTAATGCTCGAGCATTAGAGGTCCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2707s21c1
Sequence:CCGGTAGGACTCAAGTTGGACTATACTCGAGTATAGTCCAACTTGAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1803s21c1
Sequence:CCGGACACCATCTGTCATCAAATTTCTCGAGAAATTTGATGACAGATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001973
ELK4 MISSION shRNA Lentiviral Transduction Particles
ELK4, ETS-domain protein (SRF accessory protein 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001973.2-2590s1c1
Sequence:CCGGGACATTCAACATGATTGCATTCTCGAGAATGCAATCATGTTGAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2076s1c1
Sequence:CCGGCCAGACATCGACACAGACATTCTCGAGAATGTCTGTGTCGATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1882s1c1
Sequence:CCGGGCCCAAGTATTTCTCCATCTTCTCGAGAAGATGGAGAAATACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-2301s1c1
Sequence:CCGGGCTTCTCTTACACCAGCATTTCTCGAGAAATGCTGGTGTAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001973.2-1435s1c1
Sequence:CCGGCCCTCAGATACTATTATGTAACTCGAGTTACATAATAGTATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2635s21c1
Sequence:CCGGCAATGCTGATAATAGACTATTCTCGAGAATAGTCTATTATCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1318s21c1
Sequence:CCGGTGATCTGTTGGACCTCTAATGCTCGAGCATTAGAGGTCCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001973.2-2707s21c1
Sequence:CCGGTAGGACTCAAGTTGGACTATACTCGAGTATAGTCCAACTTGAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001973.2-1803s21c1
Sequence:CCGGACACCATCTGTCATCAAATTTCTCGAGAAATTTGATGACAGATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007923
VALIDATED
ELK4 MISSION shRNA Bacterial Glycerol Stock
ELK4, ETS-domain protein (SRF accessory protein 1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-916s1c1
Sequence:CCGGGCCCTAGTCTTTCTCCATCTTCTCGAGAAGATGGAGAAAGACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-699s1c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-716s1c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-844s1c1
Sequence:CCGGCCGTCATCAAATTTGTGACAACTCGAGTTGTCACAAATTTGATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-476s1c1
Sequence:CCGGCCTGCGATACTACTACGTAAACTCGAGTTTACGTAGTAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-486s21c1
Sequence:CCGGTCGCAAGAACAAGCCTAATATCTCGAGATATTAGGCTTGTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007923.2-1508s21c1
Sequence:CCGGCCAGACTGCAAGGTGCTAATACTCGAGTATTAGCACCTTGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-1715s21c1
Sequence:CCGGCGTCTGCAGTGCTCGTGATTTCTCGAGAAATCACGAGCACTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-754s21c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-771s21c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007923
VALIDATED
ELK4 MISSION shRNA shRNA Plasmid DNA
ELK4, ETS-domain protein (SRF accessory protein 1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-916s1c1
Sequence:CCGGGCCCTAGTCTTTCTCCATCTTCTCGAGAAGATGGAGAAAGACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-699s1c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-716s1c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-844s1c1
Sequence:CCGGCCGTCATCAAATTTGTGACAACTCGAGTTGTCACAAATTTGATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-476s1c1
Sequence:CCGGCCTGCGATACTACTACGTAAACTCGAGTTTACGTAGTAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-486s21c1
Sequence:CCGGTCGCAAGAACAAGCCTAATATCTCGAGATATTAGGCTTGTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007923.2-1508s21c1
Sequence:CCGGCCAGACTGCAAGGTGCTAATACTCGAGTATTAGCACCTTGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-1715s21c1
Sequence:CCGGCGTCTGCAGTGCTCGTGATTTCTCGAGAAATCACGAGCACTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-754s21c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-771s21c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007923
VALIDATED
ELK4 MISSION shRNA Lentiviral Transduction Particles
ELK4, ETS-domain protein (SRF accessory protein 1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-916s1c1
Sequence:CCGGGCCCTAGTCTTTCTCCATCTTCTCGAGAAGATGGAGAAAGACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-699s1c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-716s1c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007923.1-844s1c1
Sequence:CCGGCCGTCATCAAATTTGTGACAACTCGAGTTGTCACAAATTTGATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007923.1-476s1c1
Sequence:CCGGCCTGCGATACTACTACGTAAACTCGAGTTTACGTAGTAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-486s21c1
Sequence:CCGGTCGCAAGAACAAGCCTAATATCTCGAGATATTAGGCTTGTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007923.2-1508s21c1
Sequence:CCGGCCAGACTGCAAGGTGCTAATACTCGAGTATTAGCACCTTGCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-1715s21c1
Sequence:CCGGCGTCTGCAGTGCTCGTGATTTCTCGAGAAATCACGAGCACTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-754s21c1
Sequence:CCGGCGCAATGACTACATACACTCTCTCGAGAGAGTGTATGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007923.2-771s21c1
Sequence:CCGGCTCTGGTTTGTATTCTTCATTCTCGAGAATGAAGAATACAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks