EMAIL THIS PAGE TO A FRIEND

ELL2

elongation factor, RNA polymerase II, 2

194 Gene Product Result for
UniProtKB ID: O00472
Gene ID:
Mouse(192657) elongation factor RNA polymerase II 2
Rat(309918) elongation factor RNA polymerase II 2
Zebrafish(322997) elongation factor, RNA polymerase II, 2
cow(782605) elongation factor, RNA polymerase II, 2
Horse(100064911) elongation factor, RNA polymerase II, 2
domestic cat(101082125) elongation factor, RNA polymerase II, 2
dog(488899) elongation factor, RNA polymerase II, 2
chicken(427119) elongation factor, RNA polymerase II, 2
domestic guinea pig(100735702) elongation factor, RNA polymerase II, 2
naked mole-rat(101702716) elongation factor, RNA polymerase II, 2
sheep(101101983) elongation factor, RNA polymerase II, 2
Domestic Rabbit(100351751) elongation factor, RNA polymerase II, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012081 Rosetta Predictions human pricing
XM_001054852 Rosetta Predictions rat pricing
XM_226624 Rosetta Predictions rat pricing
NM_138953 Rosetta Predictions mouse pricing
XM_484289 Rosetta Predictions mouse pricing
XM_898358 Rosetta Predictions mouse pricing
XM_898363 Rosetta Predictions mouse pricing
XM_898369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064073 predicted 1353
2 SASI_Hs01_00064074 predicted 767
3 SASI_Hs01_00064075 predicted 912
4 SASI_Hs01_00064077 predicted 2039
5 SASI_Hs02_00343562 predicted 1010
6 SASI_Hs01_00064079 predicted 2150
7 SASI_Hs02_00343563 predicted 2010
8 SASI_Hs01_00064080 predicted 2322
9 SASI_Hs01_00064081 predicted 1311
10 SASI_Hs01_00064082 predicted 924
11 SASI_Hs01_00064076 predicted 2195
12 SASI_Hs01_00064078 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277505 predicted 2351
2 SASI_Rn02_00277506 predicted 1454
3 SASI_Rn02_00277507 predicted 1636
4 SASI_Rn02_00277508 predicted 975
5 SASI_Rn02_00277509 predicted 902
6 SASI_Rn02_00277510 predicted 1724
7 SASI_Rn02_00277511 predicted 1531
8 SASI_Rn02_00277512 predicted 1368
9 SASI_Rn02_00277513 predicted 1631
10 SASI_Rn02_00277514 predicted 2635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383755 predicted 2402
2 SASI_Rn02_00383756 predicted 1500
3 SASI_Rn02_00383757 predicted 1687
4 SASI_Rn02_00383758 predicted 1015
5 SASI_Rn02_00383759 predicted 952
6 SASI_Rn02_00383760 predicted 1772
7 SASI_Rn02_00383761 predicted 1577
8 SASI_Rn02_00383762 predicted 1412
9 SASI_Rn02_00383763 predicted 1677
10 SASI_Rn02_00383764 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339844 predicted 389
2 SASI_Mm02_00339845 predicted 1967
3 SASI_Mm02_00339846 predicted 935
4 SASI_Mm02_00339847 predicted 932
5 SASI_Mm02_00339848 predicted 1800
6 SASI_Mm02_00339849 predicted 850
7 SASI_Mm02_00339850 predicted 739
8 SASI_Mm02_00339851 predicted 491
9 SASI_Mm02_00339852 predicted 1827
10 SASI_Mm02_00339853 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247967 predicted 1076
2 SASI_Mm01_00247968 predicted 2334
3 SASI_Mm01_00247969 predicted 2691
4 SASI_Mm01_00247970 predicted 1616
5 SASI_Mm01_00247971 predicted 2823
6 SASI_Mm01_00247972 predicted 1693
7 SASI_Mm01_00247973 predicted 1808
8 SASI_Mm01_00247974 predicted 2490
9 SASI_Mm01_00247975 predicted 2794
10 SASI_Mm01_00247976 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249597 predicted 1076
2 SASI_Mm01_00249598 predicted 2342
3 SASI_Mm01_00249599 predicted 1617
4 SASI_Mm01_00249600 predicted 2408
5 SASI_Mm01_00249601 predicted 1699
6 SASI_Mm01_00249602 predicted 1801
7 SASI_Mm01_00249603 predicted 1132
8 SASI_Mm01_00249604 predicted 1534
9 SASI_Mm01_00249605 predicted 1794
10 SASI_Mm01_00249606 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205284 predicted 1076
2 SASI_Mm01_00205285 predicted 1616
3 SASI_Mm01_00205286 predicted 1618
4 SASI_Mm01_00205287 predicted 1692
5 SASI_Mm01_00205288 predicted 1800
6 SASI_Mm01_00205289 predicted 1131
7 SASI_Mm01_00205290 predicted 1528
8 SASI_Mm01_00205291 predicted 1794
9 SASI_Mm01_00205292 predicted 1431
10 SASI_Mm01_00205293 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243093 predicted 1497
2 SASI_Mm01_00243094 predicted 1489
3 SASI_Mm01_00243095 predicted 1500
4 SASI_Mm01_00243096 predicted 1544
5 SASI_Mm01_00243097 predicted 1219
6 SASI_Mm01_00243098 predicted 1074
7 SASI_Mm01_00243099 predicted 1682
8 SASI_Mm01_00243100 predicted 1164
9 SASI_Mm01_00243101 predicted 1195
10 SASI_Mm01_00243102 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012081
VALIDATED
ELL2 MISSION shRNA Bacterial Glycerol Stock
elongation factor, RNA polymerase II, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-694s1c1
Sequence:CCGGCCTGGGATTTATACAAGATAACTCGAGTTATCTTGTATAAATCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-913s1c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-515s1c1
Sequence:CCGGCGACCTTCAATCCAGTTCCAACTCGAGTTGGAACTGGATTGAAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-1975s1c1
Sequence:CCGGCCAGAATTATAAGGATGACTTCTCGAGAAGTCATCCTTATAATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012081.3-1254s1c1
Sequence:CCGGGCCGTTCAGAATCTCCTGTATCTCGAGATACAGGAGATTCTGAACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1385s21c1
Sequence:CCGGACCAACACTAAATGGTCATTTCTCGAGAAATGACCATTTAGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012081.5-2680s21c1
Sequence:CCGGTGGATAAACGTAAGCCTATTTCTCGAGAAATAGGCTTACGTTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1112s21c1
Sequence:CCGGGGACCTCTCATATACCTTAAACTCGAGTTTAAGGTATATGAGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1667s21c1
Sequence:CCGGCCCTGGTTCCGTTCTACTAAACTCGAGTTTAGTAGAACGGAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-911s21c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012081
VALIDATED
ELL2 MISSION shRNA shRNA Plasmid DNA
elongation factor, RNA polymerase II, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-694s1c1
Sequence:CCGGCCTGGGATTTATACAAGATAACTCGAGTTATCTTGTATAAATCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-913s1c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-515s1c1
Sequence:CCGGCGACCTTCAATCCAGTTCCAACTCGAGTTGGAACTGGATTGAAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-1975s1c1
Sequence:CCGGCCAGAATTATAAGGATGACTTCTCGAGAAGTCATCCTTATAATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012081.3-1254s1c1
Sequence:CCGGGCCGTTCAGAATCTCCTGTATCTCGAGATACAGGAGATTCTGAACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1385s21c1
Sequence:CCGGACCAACACTAAATGGTCATTTCTCGAGAAATGACCATTTAGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012081.5-2680s21c1
Sequence:CCGGTGGATAAACGTAAGCCTATTTCTCGAGAAATAGGCTTACGTTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1112s21c1
Sequence:CCGGGGACCTCTCATATACCTTAAACTCGAGTTTAAGGTATATGAGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1667s21c1
Sequence:CCGGCCCTGGTTCCGTTCTACTAAACTCGAGTTTAGTAGAACGGAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-911s21c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012081
VALIDATED
ELL2 MISSION shRNA Lentiviral Transduction Particles
elongation factor, RNA polymerase II, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-694s1c1
Sequence:CCGGCCTGGGATTTATACAAGATAACTCGAGTTATCTTGTATAAATCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-913s1c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-515s1c1
Sequence:CCGGCGACCTTCAATCCAGTTCCAACTCGAGTTGGAACTGGATTGAAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012081.3-1975s1c1
Sequence:CCGGCCAGAATTATAAGGATGACTTCTCGAGAAGTCATCCTTATAATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012081.3-1254s1c1
Sequence:CCGGGCCGTTCAGAATCTCCTGTATCTCGAGATACAGGAGATTCTGAACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1385s21c1
Sequence:CCGGACCAACACTAAATGGTCATTTCTCGAGAAATGACCATTTAGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012081.5-2680s21c1
Sequence:CCGGTGGATAAACGTAAGCCTATTTCTCGAGAAATAGGCTTACGTTTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1112s21c1
Sequence:CCGGGGACCTCTCATATACCTTAAACTCGAGTTTAAGGTATATGAGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-1667s21c1
Sequence:CCGGCCCTGGTTCCGTTCTACTAAACTCGAGTTTAGTAGAACGGAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_012081.5-911s21c1
Sequence:CCGGCCCTGCAAATACAATTCGAAACTCGAGTTTCGAATTGTATTTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484289
ELL2 MISSION shRNA Bacterial Glycerol Stock
elongation factor, RNA polymerase II, 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1156s1c1
Sequence:CCGGCCACCGACATTAAATGGTTATCTCGAGATAACCATTTAATGTCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-266s1c1
Sequence:CCGGGCCACAAGAATTTAATTCCTTCTCGAGAAGGAATTAAATTCTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1280s1c1
Sequence:CCGGCCAATCCTCCTCAGACTGTAACTCGAGTTACAGTCTGAGGAGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484289.1-2774s1c1
Sequence:CCGGGCCTGCATTCTCCTGTGATAACTCGAGTTATCACAGGAGAATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484289
ELL2 MISSION shRNA shRNA Plasmid DNA
elongation factor, RNA polymerase II, 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1156s1c1
Sequence:CCGGCCACCGACATTAAATGGTTATCTCGAGATAACCATTTAATGTCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-266s1c1
Sequence:CCGGGCCACAAGAATTTAATTCCTTCTCGAGAAGGAATTAAATTCTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1280s1c1
Sequence:CCGGCCAATCCTCCTCAGACTGTAACTCGAGTTACAGTCTGAGGAGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484289.1-2774s1c1
Sequence:CCGGGCCTGCATTCTCCTGTGATAACTCGAGTTATCACAGGAGAATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484289
ELL2 MISSION shRNA Lentiviral Transduction Particles
elongation factor, RNA polymerase II, 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1156s1c1
Sequence:CCGGCCACCGACATTAAATGGTTATCTCGAGATAACCATTTAATGTCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-266s1c1
Sequence:CCGGGCCACAAGAATTTAATTCCTTCTCGAGAAGGAATTAAATTCTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484289.1-1280s1c1
Sequence:CCGGCCAATCCTCCTCAGACTGTAACTCGAGTTACAGTCTGAGGAGGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484289.1-2774s1c1
Sequence:CCGGGCCTGCATTCTCCTGTGATAACTCGAGTTATCACAGGAGAATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138953
VALIDATED
ELL2 MISSION shRNA Bacterial Glycerol Stock
elongation factor, RNA polymerase II, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-1729s21c1
Sequence:CCGGCACTTGAACTCCCAGATTATTCTCGAGAATAATCTGGGAGTTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1657s21c1
Sequence:CCGGTGAGTAATGCCAGTCCAAATCCTCGAGGATTTGGACTGGCATTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-786s21c1
Sequence:CCGGAGGGACAGGGTCATCCATTTACTCGAGTAAATGGATGACCCTGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138953.2-2390s21c1
Sequence:CCGGCTTTGTCATTAGCGATGATTTCTCGAGAAATCATCGCTAATGACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1199s21c1
Sequence:CCGGACCGACATTAAATGGTTATTTCTCGAGAAATAACCATTTAATGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138953
VALIDATED
ELL2 MISSION shRNA shRNA Plasmid DNA
elongation factor, RNA polymerase II, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-1729s21c1
Sequence:CCGGCACTTGAACTCCCAGATTATTCTCGAGAATAATCTGGGAGTTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1657s21c1
Sequence:CCGGTGAGTAATGCCAGTCCAAATCCTCGAGGATTTGGACTGGCATTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-786s21c1
Sequence:CCGGAGGGACAGGGTCATCCATTTACTCGAGTAAATGGATGACCCTGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138953.2-2390s21c1
Sequence:CCGGCTTTGTCATTAGCGATGATTTCTCGAGAAATCATCGCTAATGACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1199s21c1
Sequence:CCGGACCGACATTAAATGGTTATTTCTCGAGAAATAACCATTTAATGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138953
VALIDATED
ELL2 MISSION shRNA Lentiviral Transduction Particles
elongation factor, RNA polymerase II, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-1729s21c1
Sequence:CCGGCACTTGAACTCCCAGATTATTCTCGAGAATAATCTGGGAGTTCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1657s21c1
Sequence:CCGGTGAGTAATGCCAGTCCAAATCCTCGAGGATTTGGACTGGCATTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138953.2-786s21c1
Sequence:CCGGAGGGACAGGGTCATCCATTTACTCGAGTAAATGGATGACCCTGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138953.2-2390s21c1
Sequence:CCGGCTTTGTCATTAGCGATGATTTCTCGAGAAATCATCGCTAATGACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138953.2-1199s21c1
Sequence:CCGGACCGACATTAAATGGTTATTTCTCGAGAAATAACCATTTAATGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)