EMAIL THIS PAGE TO A FRIEND

ELL

elongation factor RNA polymerase II

82 Gene Product Result for
Synonyms: C19orf17 ELL1 MEN PPP1R68
UniProtKB ID: P55199
Gene ID:
Mouse(13716) elongation factor RNA polymerase II
Rat(306347) elongation factor RNA polymerase II
Zebrafish(325221) elongation factor RNA polymerase II
chicken(420124) elongation factor RNA polymerase II
domestic cat(101087563) elongation factor RNA polymerase II
cow(506578) elongation factor RNA polymerase II
Horse(100070980) elongation factor RNA polymerase II
dog(484820) elongation factor RNA polymerase II
sheep(101109445) elongation factor RNA polymerase II
naked mole-rat(101697137) elongation factor RNA polymerase II
domestic guinea pig(100718569) elongation factor RNA polymerase II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006532 Rosetta Predictions human pricing
NM_001107304 Rosetta Predictions rat pricing
NM_007924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220156 predicted 1752
2 SASI_Hs02_00341776 predicted 1965
3 SASI_Hs01_00220158 predicted 2390
4 SASI_Hs01_00220160 predicted 200
5 SASI_Hs01_00220161 predicted 810
6 SASI_Hs02_00341777 predicted 2184
7 SASI_Hs01_00220162 predicted 1649
8 SASI_Hs01_00220163 predicted 1847
9 SASI_Hs01_00220164 predicted 822
10 SASI_Hs01_00220165 predicted 479
11 SASI_Hs01_00220157 predicted 2275
12 SASI_Hs01_00220159 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227515 predicted 553
2 SASI_Rn02_00227516 predicted 1530
3 SASI_Rn02_00227517 predicted 1253
4 SASI_Rn02_00227518 predicted 1747
5 SASI_Rn02_00227519 predicted 1018
6 SASI_Rn02_00227520 predicted 941
7 SASI_Rn02_00227521 predicted 1551
8 SASI_Rn02_00227522 predicted 1731
9 SASI_Rn02_00227523 predicted 1654
10 SASI_Rn02_00227524 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075181 predicted 1300
2 SASI_Mm02_00312751 predicted 1891
3 SASI_Mm01_00075184 predicted 304
4 SASI_Mm01_00075185 predicted 902
5 SASI_Mm01_00075186 predicted 260
6 SASI_Mm01_00075187 predicted 1755
7 SASI_Mm02_00312752 predicted 1658
8 SASI_Mm01_00075188 predicted 1674
9 SASI_Mm01_00075189 predicted 1683
10 SASI_Mm02_00312753 predicted 1440
11 SASI_Mm01_00075182 predicted 1872
12 SASI_Mm01_00075183 predicted 1532
13 SASI_Mm01_00075190 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007924
VALIDATED
ELL MISSION shRNA Bacterial Glycerol Stock
elongation factor RNA polymerase II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-460s21c1
Sequence:CCGGGCCGAAGTGCCATCGTCATTACTCGAGTAATGACGATGGCACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1745s21c1
Sequence:CCGGTGAGAAGCGACGCTGCGAATACTCGAGTATTCGCAGCGTCGCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-181s21c1
Sequence:CCGGTGAGACCTTCCATCCGATTTGCTCGAGCAAATCGGATGGAAGGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1885s21c1
Sequence:CCGGTTATATGAACTCGGCCCTTTACTCGAGTAAAGGGCCGAGTTCATATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1663s21c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007924.1-1879s1c1
Sequence:CCGGGCTGCCGTAGAGACATCTATTCTCGAGAATAGATGTCTCTACGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-280s1c1
Sequence:CCGGGCTTTGATTGCATCCAACAATCTCGAGATTGTTGGATGCAATCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1432s1c1
Sequence:CCGGCCTGTGACAATGAACCCACATCTCGAGATGTGGGTTCATTGTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1636s1c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-1466s1c1
Sequence:CCGGCCCGGACTATTTGCTGAAATACTCGAGTATTTCAGCAAATAGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007924
VALIDATED
ELL MISSION shRNA shRNA Plasmid DNA
elongation factor RNA polymerase II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-460s21c1
Sequence:CCGGGCCGAAGTGCCATCGTCATTACTCGAGTAATGACGATGGCACTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1745s21c1
Sequence:CCGGTGAGAAGCGACGCTGCGAATACTCGAGTATTCGCAGCGTCGCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-181s21c1
Sequence:CCGGTGAGACCTTCCATCCGATTTGCTCGAGCAAATCGGATGGAAGGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1885s21c1
Sequence:CCGGTTATATGAACTCGGCCCTTTACTCGAGTAAAGGGCCGAGTTCATATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1663s21c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007924.1-1879s1c1
Sequence:CCGGGCTGCCGTAGAGACATCTATTCTCGAGAATAGATGTCTCTACGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-280s1c1
Sequence:CCGGGCTTTGATTGCATCCAACAATCTCGAGATTGTTGGATGCAATCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1432s1c1
Sequence:CCGGCCTGTGACAATGAACCCACATCTCGAGATGTGGGTTCATTGTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1636s1c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-1466s1c1
Sequence:CCGGCCCGGACTATTTGCTGAAATACTCGAGTATTTCAGCAAATAGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007924
VALIDATED
ELL MISSION shRNA Lentiviral Transduction Particles
elongation factor RNA polymerase II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-460s21c1
Sequence:CCGGGCCGAAGTGCCATCGTCATTACTCGAGTAATGACGATGGCACTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1745s21c1
Sequence:CCGGTGAGAAGCGACGCTGCGAATACTCGAGTATTCGCAGCGTCGCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-181s21c1
Sequence:CCGGTGAGACCTTCCATCCGATTTGCTCGAGCAAATCGGATGGAAGGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1885s21c1
Sequence:CCGGTTATATGAACTCGGCCCTTTACTCGAGTAAAGGGCCGAGTTCATATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007924.2-1663s21c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007924.1-1879s1c1
Sequence:CCGGGCTGCCGTAGAGACATCTATTCTCGAGAATAGATGTCTCTACGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-280s1c1
Sequence:CCGGGCTTTGATTGCATCCAACAATCTCGAGATTGTTGGATGCAATCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1432s1c1
Sequence:CCGGCCTGTGACAATGAACCCACATCTCGAGATGTGGGTTCATTGTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007924.1-1636s1c1
Sequence:CCGGGCTCTGATGAGTACGAGACAACTCGAGTTGTCTCGTACTCATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007924.1-1466s1c1
Sequence:CCGGCCCGGACTATTTGCTGAAATACTCGAGTATTTCAGCAAATAGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006532
VALIDATED
ELL MISSION shRNA Bacterial Glycerol Stock
elongation factor RNA polymerase II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006532.2-2276s21c1
Sequence:CCGGTAATGAGACTTGAGTCTATTTCTCGAGAAATAGACTCAAGTCTCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-1624s21c1
Sequence:CCGGGCTACAAGAACGACTTCAATGCTCGAGCATTGAAGTCGTTCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-526s21c1
Sequence:CCGGAGAAGGTTCAGTTTCGGAAACCTCGAGGTTTCCGAAACTGAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-201s21c1
Sequence:CCGGCTGAGGCCATCTATCCGATTTCTCGAGAAATCGGATAGATGGCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-179s21c1
Sequence:CCGGCGCCAGACAGGATTCTGTTTCCTCGAGGAAACAGAATCCTGTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1530s1c1
Sequence:CCGGGCCTGACTACTTGCTGAAGTACTCGAGTACTTCAGCAAGTAGTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-482s1c1
Sequence:CCGGGCAAGAAGGTTCAGTTTCGGACTCGAGTCCGAAACTGAACCTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-342s1c1
Sequence:CCGGCCTGGGCAGCATACAGGACAACTCGAGTTGTCCTGTATGCTGCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1581s1c1
Sequence:CCGGGAGCTACAAGAACGACTTCAACTCGAGTTGAAGTCGTTCTTGTAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-136s1c1
Sequence:CCGGCGCGCCAGACAGGATTCTGTTCTCGAGAACAGAATCCTGTCTGGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006532
VALIDATED
ELL MISSION shRNA shRNA Plasmid DNA
elongation factor RNA polymerase II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006532.2-2276s21c1
Sequence:CCGGTAATGAGACTTGAGTCTATTTCTCGAGAAATAGACTCAAGTCTCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-1624s21c1
Sequence:CCGGGCTACAAGAACGACTTCAATGCTCGAGCATTGAAGTCGTTCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-526s21c1
Sequence:CCGGAGAAGGTTCAGTTTCGGAAACCTCGAGGTTTCCGAAACTGAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-201s21c1
Sequence:CCGGCTGAGGCCATCTATCCGATTTCTCGAGAAATCGGATAGATGGCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-179s21c1
Sequence:CCGGCGCCAGACAGGATTCTGTTTCCTCGAGGAAACAGAATCCTGTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1530s1c1
Sequence:CCGGGCCTGACTACTTGCTGAAGTACTCGAGTACTTCAGCAAGTAGTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-482s1c1
Sequence:CCGGGCAAGAAGGTTCAGTTTCGGACTCGAGTCCGAAACTGAACCTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-342s1c1
Sequence:CCGGCCTGGGCAGCATACAGGACAACTCGAGTTGTCCTGTATGCTGCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1581s1c1
Sequence:CCGGGAGCTACAAGAACGACTTCAACTCGAGTTGAAGTCGTTCTTGTAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-136s1c1
Sequence:CCGGCGCGCCAGACAGGATTCTGTTCTCGAGAACAGAATCCTGTCTGGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006532
VALIDATED
ELL MISSION shRNA Lentiviral Transduction Particles
elongation factor RNA polymerase II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006532.2-2276s21c1
Sequence:CCGGTAATGAGACTTGAGTCTATTTCTCGAGAAATAGACTCAAGTCTCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-1624s21c1
Sequence:CCGGGCTACAAGAACGACTTCAATGCTCGAGCATTGAAGTCGTTCTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-526s21c1
Sequence:CCGGAGAAGGTTCAGTTTCGGAAACCTCGAGGTTTCCGAAACTGAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-201s21c1
Sequence:CCGGCTGAGGCCATCTATCCGATTTCTCGAGAAATCGGATAGATGGCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006532.2-179s21c1
Sequence:CCGGCGCCAGACAGGATTCTGTTTCCTCGAGGAAACAGAATCCTGTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1530s1c1
Sequence:CCGGGCCTGACTACTTGCTGAAGTACTCGAGTACTTCAGCAAGTAGTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-482s1c1
Sequence:CCGGGCAAGAAGGTTCAGTTTCGGACTCGAGTCCGAAACTGAACCTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-342s1c1
Sequence:CCGGCCTGGGCAGCATACAGGACAACTCGAGTTGTCCTGTATGCTGCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006532.1-1581s1c1
Sequence:CCGGGAGCTACAAGAACGACTTCAACTCGAGTTGAAGTCGTTCTTGTAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006532.1-136s1c1
Sequence:CCGGCGCGCCAGACAGGATTCTGTTCTCGAGAACAGAATCCTGTCTGGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)