EMAIL THIS PAGE TO A FRIEND

ELMO1

engulfment and cell motility 1

Synonyms: CED-12 CED12 ELMO-1
UniProtKB ID: Q92556, A4D1X6, Q29R79, Q6ZTJ0, Q96PB0, Q9H0I1
Gene ID:
Human(9844) Summary: This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
Mouse(140580) engulfment and cell motility 1
Rat(361251) engulfment and cell motility 1
sheep(101114771) engulfment and cell motility 1
domestic guinea pig(100715695) engulfment and cell motility 1
naked mole-rat(101716556) engulfment and cell motility 1
Zebrafish(406364) engulfment and cell motility 1 (ced-12 homolog, C. elegans)
dog(612913) engulfment and cell motility 1
Horse(100055551) engulfment and cell motility 1
cow(509821) engulfment and cell motility 1
domestic cat(101080369) engulfment and cell motility 1
chicken(420735) engulfment and cell motility 1
Gene Class: Cytoskeleton
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039459 Rosetta Predictions human pricing
NM_014800 Rosetta Predictions human pricing
NM_130442 Rosetta Predictions human pricing
NM_001108415 Rosetta Predictions rat pricing
NM_080288 Rosetta Predictions mouse pricing
NM_198093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041707 predicted 426
2 SASI_Hs01_00041708 predicted 644
3 SASI_Hs01_00041709 predicted 378
4 SASI_Hs01_00041710 predicted 1304
5 SASI_Hs01_00041711 predicted 1296
6 SASI_Hs01_00041712 predicted 865
7 SASI_Hs02_00308510 predicted 502
8 SASI_Hs01_00041714 predicted 721
9 SASI_Hs01_00041715 predicted 937
10 SASI_Hs01_00041716 predicted 1361
11 SASI_Hs01_00041713 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077428 predicted 2029
2 SASI_Hs01_00077429 predicted 2236
3 SASI_Hs01_00077430 predicted 1973
4 SASI_Hs01_00077431 predicted 2902
5 SASI_Hs01_00077432 predicted 2896
6 SASI_Hs01_00077433 predicted 2467
7 SASI_Hs02_00346307 predicted 2107
8 SASI_Hs01_00077435 predicted 2319
9 SASI_Hs01_00077436 predicted 2529
10 SASI_Hs01_00077437 predicted 2968
11 SASI_Hs01_00077434 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098917 predicted 472
2 SASI_Hs01_00098918 predicted 686
3 SASI_Hs01_00098919 predicted 427
4 SASI_Hs01_00098920 predicted 1354
5 SASI_Hs01_00098921 predicted 1344
6 SASI_Hs01_00098922 predicted 908
7 SASI_Hs01_00098923 predicted 556
8 SASI_Hs01_00098925 predicted 769
9 SASI_Hs01_00098926 predicted 981
10 SASI_Hs02_00362742 predicted 1416
11 SASI_Hs01_00098924 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238429 predicted 2661
2 SASI_Rn02_00238430 predicted 2648
3 SASI_Rn02_00238431 predicted 871
4 SASI_Rn02_00238432 predicted 2064
5 SASI_Rn02_00238433 predicted 2235
6 SASI_Rn02_00238434 predicted 2433
7 SASI_Rn02_00238435 predicted 653
8 SASI_Rn02_00238436 predicted 1463
9 SASI_Rn02_00238437 predicted 2419
10 SASI_Rn02_00238438 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080775 predicted 268
2 SASI_Mm02_00338081 predicted 1794
3 SASI_Mm01_00080776 predicted 969
4 SASI_Mm01_00080777 predicted 1939
5 SASI_Mm01_00080778 predicted 1559
6 SASI_Mm01_00080779 predicted 1043
7 SASI_Mm01_00080780 predicted 1735
8 SASI_Mm01_00080781 predicted 1627
9 SASI_Mm01_00080783 predicted 729
10 SASI_Mm01_00080784 predicted 797
11 SASI_Mm01_00080782 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350815 predicted 427
2 SASI_Mm01_00156897 predicted 425
3 SASI_Mm01_00156898 predicted 553
4 SASI_Mm01_00156899 predicted 225
5 SASI_Mm01_00156900 predicted 688
6 SASI_Mm01_00156901 predicted 320
7 SASI_Mm01_00156902 predicted 362
8 SASI_Mm01_00156903 predicted 494
9 SASI_Mm01_00156904 predicted 367
10 SASI_Mm01_00156905 predicted 384
11 SASI_Mm01_00156906 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198093
ELMO1 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198093.2-1227s1c1
Sequence:CCGGCCTCTCATTATATCCAGCTATCTCGAGATAGCTGGATATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-686s1c1
Sequence:CCGGCCATCTTATACGACTCAAATTCTCGAGAATTTGAGTCGTATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-499s1c1
Sequence:CCGGCCAAATCACAAGGTCTTACATCTCGAGATGTAAGACCTTGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-685s1c1
Sequence:CCGGTCCATCTTATACGACTCAAATCTCGAGATTTGAGTCGTATAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-696s1c1
Sequence:CCGGCGACTCAAATTGCCAACTGAACTCGAGTTCAGTTGGCAATTTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-385s21c1
Sequence:CCGGGAAATCTTAGAGCTGATTAAACTCGAGTTTAATCAGCTCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198093.2-1117s21c1
Sequence:CCGGCACCTTCTACTTCAATCTATTCTCGAGAATAGATTGAAGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-562s21c1
Sequence:CCGGGATTCCCTGCAGGACAAATTGCTCGAGCAATTTGTCCTGCAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198093
ELMO1 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198093.2-1227s1c1
Sequence:CCGGCCTCTCATTATATCCAGCTATCTCGAGATAGCTGGATATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-686s1c1
Sequence:CCGGCCATCTTATACGACTCAAATTCTCGAGAATTTGAGTCGTATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-499s1c1
Sequence:CCGGCCAAATCACAAGGTCTTACATCTCGAGATGTAAGACCTTGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-685s1c1
Sequence:CCGGTCCATCTTATACGACTCAAATCTCGAGATTTGAGTCGTATAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-696s1c1
Sequence:CCGGCGACTCAAATTGCCAACTGAACTCGAGTTCAGTTGGCAATTTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-385s21c1
Sequence:CCGGGAAATCTTAGAGCTGATTAAACTCGAGTTTAATCAGCTCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198093.2-1117s21c1
Sequence:CCGGCACCTTCTACTTCAATCTATTCTCGAGAATAGATTGAAGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-562s21c1
Sequence:CCGGGATTCCCTGCAGGACAAATTGCTCGAGCAATTTGTCCTGCAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198093
ELMO1 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198093.2-1227s1c1
Sequence:CCGGCCTCTCATTATATCCAGCTATCTCGAGATAGCTGGATATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-686s1c1
Sequence:CCGGCCATCTTATACGACTCAAATTCTCGAGAATTTGAGTCGTATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-499s1c1
Sequence:CCGGCCAAATCACAAGGTCTTACATCTCGAGATGTAAGACCTTGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-685s1c1
Sequence:CCGGTCCATCTTATACGACTCAAATCTCGAGATTTGAGTCGTATAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198093.2-696s1c1
Sequence:CCGGCGACTCAAATTGCCAACTGAACTCGAGTTCAGTTGGCAATTTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-385s21c1
Sequence:CCGGGAAATCTTAGAGCTGATTAAACTCGAGTTTAATCAGCTCTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198093.2-1117s21c1
Sequence:CCGGCACCTTCTACTTCAATCTATTCTCGAGAATAGATTGAAGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198093.2-562s21c1
Sequence:CCGGGATTCCCTGCAGGACAAATTGCTCGAGCAATTTGTCCTGCAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014800
ELMO1 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-413s1c1
Sequence:CCGGCCGATAGTTCAAACTTCTATACTCGAGTATAGAAGTTTGAACTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1993s1c1
Sequence:CCGGCCAAATCACAAAGTCCTGCATCTCGAGATGCAGGACTTTGTGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-974s1c1
Sequence:CCGGCCTATACTATTGCAGTGATTACTCGAGTAATCACTGCAATAGTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-307s1c1
Sequence:CCGGCCCAAACTCATGGAAATTGATCTCGAGATCAATTTCCATGAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1875s1c1
Sequence:CCGGGCCAGAAATCTTAGAGCTGATCTCGAGATCAGCTCTAAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014800.9-2902s21c1
Sequence:CCGGAGGAAATGGCCTAGCTATTTGCTCGAGCAAATAGCTAGGCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014800.9-1356s21c1
Sequence:CCGGCCATGTACACGCGAGATTATACTCGAGTATAATCTCGCGTGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014800
ELMO1 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-413s1c1
Sequence:CCGGCCGATAGTTCAAACTTCTATACTCGAGTATAGAAGTTTGAACTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1993s1c1
Sequence:CCGGCCAAATCACAAAGTCCTGCATCTCGAGATGCAGGACTTTGTGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-974s1c1
Sequence:CCGGCCTATACTATTGCAGTGATTACTCGAGTAATCACTGCAATAGTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-307s1c1
Sequence:CCGGCCCAAACTCATGGAAATTGATCTCGAGATCAATTTCCATGAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1875s1c1
Sequence:CCGGGCCAGAAATCTTAGAGCTGATCTCGAGATCAGCTCTAAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014800.9-2902s21c1
Sequence:CCGGAGGAAATGGCCTAGCTATTTGCTCGAGCAAATAGCTAGGCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014800.9-1356s21c1
Sequence:CCGGCCATGTACACGCGAGATTATACTCGAGTATAATCTCGCGTGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014800
ELMO1 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-413s1c1
Sequence:CCGGCCGATAGTTCAAACTTCTATACTCGAGTATAGAAGTTTGAACTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1993s1c1
Sequence:CCGGCCAAATCACAAAGTCCTGCATCTCGAGATGCAGGACTTTGTGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-974s1c1
Sequence:CCGGCCTATACTATTGCAGTGATTACTCGAGTAATCACTGCAATAGTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-307s1c1
Sequence:CCGGCCCAAACTCATGGAAATTGATCTCGAGATCAATTTCCATGAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014800.8-1875s1c1
Sequence:CCGGGCCAGAAATCTTAGAGCTGATCTCGAGATCAGCTCTAAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014800.9-2902s21c1
Sequence:CCGGAGGAAATGGCCTAGCTATTTGCTCGAGCAAATAGCTAGGCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014800.9-1356s21c1
Sequence:CCGGCCATGTACACGCGAGATTATACTCGAGTATAATCTCGCGTGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks