EMAIL THIS PAGE TO A FRIEND

ELMO2

engulfment and cell motility 2

206 Gene Product Result for
Synonyms: CED-12 CED12 ELMO-2
Gene ID:
Human(63916) Summary: The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(140579) engulfment and cell motility 2
Rat(362271) engulfment and cell motility 2
chicken(419307) engulfment and cell motility 2
dog(477251) engulfment and cell motility 2
cow(508361) engulfment and cell motility 2
Horse(100056774) engulfment and cell motility 2
domestic cat(101083071) engulfment and cell motility 2
naked mole-rat(101713990) engulfment and cell motility 2
domestic guinea pig(100722891) engulfment and cell motility 2
sheep(101114633) engulfment and cell motility 2
Domestic Rabbit(100349794) engulfment and cell motility 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022086 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145581 MISSION® esiRNA esiRNA human ELMO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133171 Rosetta Predictions human pricing
NM_182764 Rosetta Predictions human pricing
NM_001134955 Rosetta Predictions rat pricing
XM_001072606 Rosetta Predictions rat pricing
NM_080287 Rosetta Predictions mouse pricing
NM_207705 Rosetta Predictions mouse pricing
NM_207706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078452 predicted 2342
2 SASI_Hs01_00078453 predicted 425
3 SASI_Hs02_00362930 predicted 614
4 SASI_Hs01_00078454 predicted 980
5 SASI_Hs01_00078455 predicted 1262
6 SASI_Hs01_00078456 predicted 558
7 SASI_Hs02_00362931 predicted 1557
8 SASI_Hs01_00078457 predicted 2422
9 SASI_Hs01_00078458 predicted 956
10 SASI_Hs01_00078459 predicted 1496
11 SASI_Hs01_00078460 predicted 1932
12 SASI_Hs01_00078461 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191036 predicted 2234
2 SASI_Hs01_00191037 predicted 314
3 SASI_Hs02_00370928 predicted 506
4 SASI_Hs01_00191038 predicted 879
5 SASI_Hs01_00191039 predicted 1153
6 SASI_Hs01_00191040 predicted 449
7 SASI_Hs02_00370929 predicted 1446
8 SASI_Hs01_00191041 predicted 2324
9 SASI_Hs01_00191042 predicted 856
10 SASI_Hs01_00191043 predicted 1393
11 SASI_Hs01_00191044 predicted 1828
12 SASI_Hs01_00191045 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259054 predicted 385
2 SASI_Rn02_00259055 predicted 1047
3 SASI_Rn02_00259056 predicted 353
4 SASI_Rn02_00259057 predicted 2042
5 SASI_Rn02_00259058 predicted 1934
6 SASI_Rn02_00259059 predicted 2062
7 SASI_Rn02_00259060 predicted 2031
8 SASI_Rn02_00259061 predicted 1040
9 SASI_Rn02_00259062 predicted 1412
10 SASI_Rn02_00259063 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339838 predicted 392
2 SASI_Rn02_00339839 predicted 1045
3 SASI_Rn02_00339840 predicted 346
4 SASI_Rn02_00339841 predicted 2035
5 SASI_Rn02_00339842 predicted 1934
6 SASI_Rn02_00339843 predicted 2058
7 SASI_Rn02_00339844 predicted 2030
8 SASI_Rn02_00339845 predicted 1037
9 SASI_Rn02_00339846 predicted 1413
10 SASI_Rn02_00339847 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172399 predicted 401
2 SASI_Mm01_00172400 predicted 1125
3 SASI_Mm01_00172402 predicted 591
4 SASI_Mm01_00172403 predicted 1376
5 SASI_Mm01_00172404 predicted 531
6 SASI_Mm01_00172405 predicted 1828
7 SASI_Mm01_00172406 predicted 1549
8 SASI_Mm01_00172407 predicted 1591
9 SASI_Mm01_00172408 predicted 615
10 SASI_Mm02_00338080 predicted 1666
11 SASI_Mm01_00172401 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053610 predicted 590
2 SASI_Mm01_00053611 predicted 1318
3 SASI_Mm01_00053613 predicted 782
4 SASI_Mm01_00053614 predicted 1560
5 SASI_Mm01_00053615 predicted 729
6 SASI_Mm01_00053616 predicted 2018
7 SASI_Mm01_00053617 predicted 1740
8 SASI_Mm01_00053618 predicted 1781
9 SASI_Mm01_00053619 predicted 804
10 SASI_Mm02_00352243 predicted 1857
11 SASI_Mm01_00053612 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103094 predicted 402
2 SASI_Mm01_00103095 predicted 1155
3 SASI_Mm01_00103097 predicted 590
4 SASI_Mm01_00103098 predicted 1408
5 SASI_Mm01_00103099 predicted 536
6 SASI_Mm01_00103100 predicted 1863
7 SASI_Mm01_00103101 predicted 1582
8 SASI_Mm01_00103102 predicted 1624
9 SASI_Mm01_00103103 predicted 610
10 SASI_Mm02_00352244 predicted 1698
11 SASI_Mm01_00103096 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207705
VALIDATED
ELMO2 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-558s21c1
Sequence:CCGGAGGACCCAGTCATCTAGTATGCTCGAGCATACTAGATGACTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-2561s21c1
Sequence:CCGGTCTTTGTAATCTCGCAGTTACCTCGAGGTAACTGCGAGATTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-2709s21c1
Sequence:CCGGACTCAGTCAACTCGTTGTTAACTCGAGTTAACAACGAGTTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-875s21c1
Sequence:CCGGCCTAGAGAGCATGGTACTAAACTCGAGTTTAGTACCATGCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-987s21c1
Sequence:CCGGTACGCCATTGCTCTGATTAACCTCGAGGTTAATCAGAGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-338s21c1
Sequence:CCGGTAACGCCCAGCTCCTTGAAATCTCGAGATTTCAAGGAGCTGGGCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-1317s21c1
Sequence:CCGGATGTATACCAAGGACTATAAACTCGAGTTTATAGTCCTTGGTATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207705.1-2965s1c1
Sequence:CCGGGCCTACCTTTGTCTCCTAAATCTCGAGATTTAGGAGACAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-2187s1c1
Sequence:CCGGGCCTTCTCCATCCTGTATGATCTCGAGATCATACAGGATGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1742s1c1
Sequence:CCGGGCCCTCTAAACCCAACTCTTTCTCGAGAAAGAGTTGGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1077s1c1
Sequence:CCGGCGGTCCATAATCCTGAACCATCTCGAGATGGTTCAGGATTATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1687s1c1
Sequence:CCGGCCGAGGATTTCAACAAGGTTACTCGAGTAACCTTGTTGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207705
VALIDATED
ELMO2 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-558s21c1
Sequence:CCGGAGGACCCAGTCATCTAGTATGCTCGAGCATACTAGATGACTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-2561s21c1
Sequence:CCGGTCTTTGTAATCTCGCAGTTACCTCGAGGTAACTGCGAGATTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-2709s21c1
Sequence:CCGGACTCAGTCAACTCGTTGTTAACTCGAGTTAACAACGAGTTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-875s21c1
Sequence:CCGGCCTAGAGAGCATGGTACTAAACTCGAGTTTAGTACCATGCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-987s21c1
Sequence:CCGGTACGCCATTGCTCTGATTAACCTCGAGGTTAATCAGAGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-338s21c1
Sequence:CCGGTAACGCCCAGCTCCTTGAAATCTCGAGATTTCAAGGAGCTGGGCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-1317s21c1
Sequence:CCGGATGTATACCAAGGACTATAAACTCGAGTTTATAGTCCTTGGTATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207705.1-2965s1c1
Sequence:CCGGGCCTACCTTTGTCTCCTAAATCTCGAGATTTAGGAGACAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-2187s1c1
Sequence:CCGGGCCTTCTCCATCCTGTATGATCTCGAGATCATACAGGATGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1742s1c1
Sequence:CCGGGCCCTCTAAACCCAACTCTTTCTCGAGAAAGAGTTGGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1077s1c1
Sequence:CCGGCGGTCCATAATCCTGAACCATCTCGAGATGGTTCAGGATTATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1687s1c1
Sequence:CCGGCCGAGGATTTCAACAAGGTTACTCGAGTAACCTTGTTGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207705
VALIDATED
ELMO2 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-558s21c1
Sequence:CCGGAGGACCCAGTCATCTAGTATGCTCGAGCATACTAGATGACTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207705.1-2561s21c1
Sequence:CCGGTCTTTGTAATCTCGCAGTTACCTCGAGGTAACTGCGAGATTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-2709s21c1
Sequence:CCGGACTCAGTCAACTCGTTGTTAACTCGAGTTAACAACGAGTTGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-875s21c1
Sequence:CCGGCCTAGAGAGCATGGTACTAAACTCGAGTTTAGTACCATGCTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-987s21c1
Sequence:CCGGTACGCCATTGCTCTGATTAACCTCGAGGTTAATCAGAGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-338s21c1
Sequence:CCGGTAACGCCCAGCTCCTTGAAATCTCGAGATTTCAAGGAGCTGGGCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207705.1-1317s21c1
Sequence:CCGGATGTATACCAAGGACTATAAACTCGAGTTTATAGTCCTTGGTATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207705.1-2965s1c1
Sequence:CCGGGCCTACCTTTGTCTCCTAAATCTCGAGATTTAGGAGACAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-2187s1c1
Sequence:CCGGGCCTTCTCCATCCTGTATGATCTCGAGATCATACAGGATGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1742s1c1
Sequence:CCGGGCCCTCTAAACCCAACTCTTTCTCGAGAAAGAGTTGGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1077s1c1
Sequence:CCGGCGGTCCATAATCCTGAACCATCTCGAGATGGTTCAGGATTATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207705.1-1687s1c1
Sequence:CCGGCCGAGGATTTCAACAAGGTTACTCGAGTAACCTTGTTGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133171
VALIDATED
ELMO2 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1162s21c1
Sequence:CCGGGAACTGAGGAGGATTGCATTTCTCGAGAAATGCAATCCTCCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1051s21c1
Sequence:CCGGGAGATGGCCCATCAGCTATATCTCGAGATATAGCTGATGGGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-990s21c1
Sequence:CCGGGAAGCATCTCCGGTCTATAATCTCGAGATTATAGACCGGAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-910s21c1
Sequence:CCGGTACGCCATTGCACTGATTAATCTCGAGATTAATCAGTGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133171.3-2804s21c1
Sequence:CCGGCTTGAAGTGACTACCTGTATCCTCGAGGATACAGGTAGTCACTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133171.3-707s21c1
Sequence:CCGGACATGGTTTCAATCACCTTTACTCGAGTAAAGGTGATTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133171
VALIDATED
ELMO2 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1162s21c1
Sequence:CCGGGAACTGAGGAGGATTGCATTTCTCGAGAAATGCAATCCTCCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1051s21c1
Sequence:CCGGGAGATGGCCCATCAGCTATATCTCGAGATATAGCTGATGGGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-990s21c1
Sequence:CCGGGAAGCATCTCCGGTCTATAATCTCGAGATTATAGACCGGAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-910s21c1
Sequence:CCGGTACGCCATTGCACTGATTAATCTCGAGATTAATCAGTGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133171.3-2804s21c1
Sequence:CCGGCTTGAAGTGACTACCTGTATCCTCGAGGATACAGGTAGTCACTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133171.3-707s21c1
Sequence:CCGGACATGGTTTCAATCACCTTTACTCGAGTAAAGGTGATTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133171
VALIDATED
ELMO2 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1162s21c1
Sequence:CCGGGAACTGAGGAGGATTGCATTTCTCGAGAAATGCAATCCTCCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-1051s21c1
Sequence:CCGGGAGATGGCCCATCAGCTATATCTCGAGATATAGCTGATGGGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-990s21c1
Sequence:CCGGGAAGCATCTCCGGTCTATAATCTCGAGATTATAGACCGGAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_133171.3-910s21c1
Sequence:CCGGTACGCCATTGCACTGATTAATCTCGAGATTAATCAGTGCAATGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133171.3-2804s21c1
Sequence:CCGGCTTGAAGTGACTACCTGTATCCTCGAGGATACAGGTAGTCACTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133171.3-707s21c1
Sequence:CCGGACATGGTTTCAATCACCTTTACTCGAGTAAAGGTGATTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022086
VALIDATED
ELMO2 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-1000s1c1
Sequence:CCGGCGGTCTATAATCCTGAATCATCTCGAGATGATTCAGGATTATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-1263s1c1
Sequence:CCGGGCTGGGATTTACCAACCACATCTCGAGATGTGGTTGGTAAATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-301s1c1
Sequence:CCGGGCATCCATTATCAAGGAAGTTCTCGAGAACTTCCTTGATAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-270s1c1
Sequence:CCGGGCTCCTTGAAATCGACCAGAACTCGAGTTCTGGTCGATTTCAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-2130s1c1
Sequence:CCGGCCCTGATGAGACCTTAAACTTCTCGAGAAGTTTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022086
VALIDATED
ELMO2 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-1000s1c1
Sequence:CCGGCGGTCTATAATCCTGAATCATCTCGAGATGATTCAGGATTATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-1263s1c1
Sequence:CCGGGCTGGGATTTACCAACCACATCTCGAGATGTGGTTGGTAAATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-301s1c1
Sequence:CCGGGCATCCATTATCAAGGAAGTTCTCGAGAACTTCCTTGATAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-270s1c1
Sequence:CCGGGCTCCTTGAAATCGACCAGAACTCGAGTTCTGGTCGATTTCAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-2130s1c1
Sequence:CCGGCCCTGATGAGACCTTAAACTTCTCGAGAAGTTTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022086
VALIDATED
ELMO2 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-1000s1c1
Sequence:CCGGCGGTCTATAATCCTGAATCATCTCGAGATGATTCAGGATTATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-1263s1c1
Sequence:CCGGGCTGGGATTTACCAACCACATCTCGAGATGTGGTTGGTAAATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-301s1c1
Sequence:CCGGGCATCCATTATCAAGGAAGTTCTCGAGAACTTCCTTGATAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022086.6-270s1c1
Sequence:CCGGGCTCCTTGAAATCGACCAGAACTCGAGTTCTGGTCGATTTCAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022086.6-2130s1c1
Sequence:CCGGCCCTGATGAGACCTTAAACTTCTCGAGAAGTTTAAGGTCTCATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks