EMAIL THIS PAGE TO A FRIEND

ELMO3

engulfment and cell motility 3

52 Gene Product Result for
Synonyms: CED-12 CED12 ELMO-3
UniProtKB ID: Q96BJ8, B4DV86, Q9H8A5
Gene ID:
Human(79767) Summary: The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Mouse(234683) engulfment and cell motility 3
Rat(291962) engulfment and cell motility 3
chicken(100857533) engulfment and cell motility 3
cow(525427) engulfment and cell motility 3
domestic cat(101098506) engulfment and cell motility 3
dog(489763) engulfment and cell motility 3
sheep(101107217) engulfment and cell motility 3
domestic guinea pig(100734823) engulfment and cell motility 3
naked mole-rat(101717268) engulfment and cell motility 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500351 Anti-ELMO3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV42635 Anti-ELMO3 antibody produced in rabbit affinity isolated antibody bovine, canine, guinea pig, mouse, rat, human, horse, rabbit
western blot pricing
HPA021484 Anti-ELMO3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031911 MISSION® esiRNA esiRNA targeting mouse Elmo3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024712 Rosetta Predictions human pricing
NM_001030028 Rosetta Predictions rat pricing
NM_172760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190706 predicted 367
2 SASI_Hs01_00190707 predicted 1012
3 SASI_Hs01_00190708 predicted 573
4 SASI_Hs01_00190709 predicted 337
5 SASI_Hs01_00190710 predicted 1662
6 SASI_Hs01_00190711 predicted 380
7 SASI_Hs01_00190712 predicted 1305
8 SASI_Hs01_00190713 predicted 1479
9 SASI_Hs01_00190714 predicted 1988
10 SASI_Hs01_00190715 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057554 predicted 317
2 SASI_Rn02_00203535 predicted 274
3 SASI_Rn01_00057555 predicted 1462
4 SASI_Rn02_00203536 predicted 1887
5 SASI_Rn01_00057556 predicted 1342
6 SASI_Rn01_00057557 predicted 2127
7 SASI_Rn01_00057558 predicted 2183
8 SASI_Rn01_00057560 predicted 1434
9 SASI_Rn01_00057561 predicted 1273
10 SASI_Rn01_00057562 predicted 258
11 SASI_Rn01_00057559 predicted 1595
12 SASI_Rn01_00057563 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121982 predicted 2190
2 SASI_Mm01_00121983 predicted 2372
3 SASI_Mm01_00121984 predicted 2353
4 SASI_Mm01_00121985 predicted 1944
5 SASI_Mm01_00121986 predicted 1932
6 SASI_Mm01_00121987 predicted 325
7 SASI_Mm01_00121988 predicted 518
8 SASI_Mm01_00121989 predicted 2396
9 SASI_Mm01_00121990 predicted 276
10 SASI_Mm01_00121991 predicted 1266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024712
ELMO3 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-705s1c1
Sequence:CCGGCGCAAGCACATGCTTGACTATCTCGAGATAGTCAAGCATGTGCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1439s1c1
Sequence:CCGGCAAGGTGAATGCGCTCACTTACTCGAGTAAGTGAGCGCATTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-344s1c1
Sequence:CCGGCCAGATACTAGGCACCATCATCTCGAGATGATGGTGCCTAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1817s1c1
Sequence:CCGGGAAGCAGAACAAGGACCTCTACTCGAGTAGAGGTCCTTGTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1878s1c1
Sequence:CCGGGAAGCGTACCTCAACTTCATTCTCGAGAATGAAGTTGAGGTACGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-1048s21c1
Sequence:CCGGGTACGTACTGCAGGCTCTCATCTCGAGATGAGAGCCTGCAGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-531s21c1
Sequence:CCGGTGGCCTCGGACATGATCTTTGCTCGAGCAAAGATCATGTCCGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-715s21c1
Sequence:CCGGGGTGGTGTGCTACGTGAACATCTCGAGATGTTCACGTAGCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024712
ELMO3 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-705s1c1
Sequence:CCGGCGCAAGCACATGCTTGACTATCTCGAGATAGTCAAGCATGTGCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1439s1c1
Sequence:CCGGCAAGGTGAATGCGCTCACTTACTCGAGTAAGTGAGCGCATTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-344s1c1
Sequence:CCGGCCAGATACTAGGCACCATCATCTCGAGATGATGGTGCCTAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1817s1c1
Sequence:CCGGGAAGCAGAACAAGGACCTCTACTCGAGTAGAGGTCCTTGTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1878s1c1
Sequence:CCGGGAAGCGTACCTCAACTTCATTCTCGAGAATGAAGTTGAGGTACGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-1048s21c1
Sequence:CCGGGTACGTACTGCAGGCTCTCATCTCGAGATGAGAGCCTGCAGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-531s21c1
Sequence:CCGGTGGCCTCGGACATGATCTTTGCTCGAGCAAAGATCATGTCCGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-715s21c1
Sequence:CCGGGGTGGTGTGCTACGTGAACATCTCGAGATGTTCACGTAGCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024712
ELMO3 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-705s1c1
Sequence:CCGGCGCAAGCACATGCTTGACTATCTCGAGATAGTCAAGCATGTGCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1439s1c1
Sequence:CCGGCAAGGTGAATGCGCTCACTTACTCGAGTAAGTGAGCGCATTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-344s1c1
Sequence:CCGGCCAGATACTAGGCACCATCATCTCGAGATGATGGTGCCTAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1817s1c1
Sequence:CCGGGAAGCAGAACAAGGACCTCTACTCGAGTAGAGGTCCTTGTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024712.2-1878s1c1
Sequence:CCGGGAAGCGTACCTCAACTTCATTCTCGAGAATGAAGTTGAGGTACGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-1048s21c1
Sequence:CCGGGTACGTACTGCAGGCTCTCATCTCGAGATGAGAGCCTGCAGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-531s21c1
Sequence:CCGGTGGCCTCGGACATGATCTTTGCTCGAGCAAAGATCATGTCCGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024712.3-715s21c1
Sequence:CCGGGGTGGTGTGCTACGTGAACATCTCGAGATGTTCACGTAGCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172760
ELMO3 MISSION shRNA Bacterial Glycerol Stock
engulfment and cell motility 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-924s1c1
Sequence:CCGGCCAGTTCATCTACAAGAACATCTCGAGATGTTCTTGTAGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-519s1c1
Sequence:CCGGGCTTCAGAAACTAAGCACCATCTCGAGATGGTGCTTAGTTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172760.1-2318s1c1
Sequence:CCGGGCCACAGTTGATACTGCTATACTCGAGTATAGCAGTATCAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172760.2-2331s21c1
Sequence:CCGGTGCTATAGCAGCCACGAAATCCTCGAGGATTTCGTGGCTGCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1165s21c1
Sequence:CCGGTCCGAGAGTTCCGCAAGTTAGCTCGAGCTAACTTGCGGAACTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1477s21c1
Sequence:CCGGTGGCTATCCAGCTACTGAATACTCGAGTATTCAGTAGCTGGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1934s21c1
Sequence:CCGGAGACATCAGGGCACTCCTAATCTCGAGATTAGGAGTGCCCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1316s21c1
Sequence:CCGGCCGAGAGGACAAGCATGAATGCTCGAGCATTCATGCTTGTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172760
ELMO3 MISSION shRNA shRNA Plasmid DNA
engulfment and cell motility 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-924s1c1
Sequence:CCGGCCAGTTCATCTACAAGAACATCTCGAGATGTTCTTGTAGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-519s1c1
Sequence:CCGGGCTTCAGAAACTAAGCACCATCTCGAGATGGTGCTTAGTTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172760.1-2318s1c1
Sequence:CCGGGCCACAGTTGATACTGCTATACTCGAGTATAGCAGTATCAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172760.2-2331s21c1
Sequence:CCGGTGCTATAGCAGCCACGAAATCCTCGAGGATTTCGTGGCTGCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1165s21c1
Sequence:CCGGTCCGAGAGTTCCGCAAGTTAGCTCGAGCTAACTTGCGGAACTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1477s21c1
Sequence:CCGGTGGCTATCCAGCTACTGAATACTCGAGTATTCAGTAGCTGGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1934s21c1
Sequence:CCGGAGACATCAGGGCACTCCTAATCTCGAGATTAGGAGTGCCCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1316s21c1
Sequence:CCGGCCGAGAGGACAAGCATGAATGCTCGAGCATTCATGCTTGTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172760
ELMO3 MISSION shRNA Lentiviral Transduction Particles
engulfment and cell motility 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-924s1c1
Sequence:CCGGCCAGTTCATCTACAAGAACATCTCGAGATGTTCTTGTAGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172760.1-519s1c1
Sequence:CCGGGCTTCAGAAACTAAGCACCATCTCGAGATGGTGCTTAGTTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172760.1-2318s1c1
Sequence:CCGGGCCACAGTTGATACTGCTATACTCGAGTATAGCAGTATCAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172760.2-2331s21c1
Sequence:CCGGTGCTATAGCAGCCACGAAATCCTCGAGGATTTCGTGGCTGCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1165s21c1
Sequence:CCGGTCCGAGAGTTCCGCAAGTTAGCTCGAGCTAACTTGCGGAACTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1477s21c1
Sequence:CCGGTGGCTATCCAGCTACTGAATACTCGAGTATTCAGTAGCTGGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1934s21c1
Sequence:CCGGAGACATCAGGGCACTCCTAATCTCGAGATTAGGAGTGCCCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172760.2-1316s21c1
Sequence:CCGGCCGAGAGGACAAGCATGAATGCTCGAGCATTCATGCTTGTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks