EMAIL THIS PAGE TO A FRIEND

ELMOD1

ELMO/CED-12 domain containing 1

UniProtKB ID: Q8N336, B4E167, G5E9S5, Q9NPW3
Gene ID:
Mouse(270162) ELMO/CED-12 domain containing 1
Rat(315670) ELMO/CED-12 domain containing 1
naked mole-rat(101704605) ELMO/CED-12 domain containing 1
domestic guinea pig(100716591) ELMO/CED-12 domain containing 1
sheep(101104337) ELMO/CED-12 domain containing 1
Zebrafish(791199) ELMO/CED-12 domain containing 1
chicken(418971) ELMO/CED-12 domain containing 1
cow(768233) ELMO/CED-12 domain containing 1
domestic cat(101088025) ELMO/CED-12 domain containing 1
dog(489423) ELMO/CED-12 domain containing 1
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018712 Rosetta Predictions human pricing
XM_236245 Rosetta Predictions rat pricing
XR_008801 Rosetta Predictions rat pricing
NM_177769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128976 predicted 670
2 SASI_Hs01_00128977 predicted 684
3 SASI_Hs02_00352242 predicted 243
4 SASI_Hs01_00128978 predicted 849
5 SASI_Hs01_00128979 predicted 975
6 SASI_Hs01_00128980 predicted 562
7 SASI_Hs01_00128981 predicted 313
8 SASI_Hs01_00128982 predicted 758
9 SASI_Hs01_00128984 predicted 585
10 SASI_Hs01_00128985 predicted 1079
11 SASI_Hs01_00128983 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151864 predicted 975
2 SASI_Rn01_00151865 predicted 1002
3 SASI_Rn01_00151866 predicted 1224
4 SASI_Rn01_00151867 predicted 515
5 SASI_Rn01_00151868 predicted 1230
6 SASI_Rn01_00151869 predicted 1205
7 SASI_Rn01_00151870 predicted 305
8 SASI_Rn01_00151871 predicted 984
9 SASI_Rn01_00151872 predicted 883
10 SASI_Rn01_00151873 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165166 predicted 2026
2 SASI_Rn01_00165167 predicted 2323
3 SASI_Rn01_00165168 predicted 1167
4 SASI_Rn01_00165169 predicted 2320
5 SASI_Rn01_00165170 predicted 1196
6 SASI_Rn02_00417948 predicted 2316
7 SASI_Rn01_00165172 predicted 2013
8 SASI_Rn01_00165174 predicted 2216
9 SASI_Rn01_00165175 predicted 2064
10 SASI_Rn02_00417949 predicted 1176
11 SASI_Rn01_00165171 predicted 2328
12 SASI_Rn01_00165173 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040492 predicted 1141
2 SASI_Mm02_00348153 predicted 892
3 SASI_Mm02_00348154 predicted 594
4 SASI_Mm01_00040493 predicted 1167
5 SASI_Mm01_00040494 predicted 682
6 SASI_Mm01_00040496 predicted 365
7 SASI_Mm01_00040498 predicted 551
8 SASI_Mm01_00040499 predicted 1055
9 SASI_Mm01_00040500 predicted 1156
10 SASI_Mm01_00040501 predicted 1046
11 SASI_Mm01_00040495 predicted 901
12 SASI_Mm01_00040497 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177769
ELMOD1 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1218s21c1
Sequence:CCGGATGGACATAATGGAGTTTAATCTCGAGATTAAACTCCATTATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177769.4-1429s21c1
Sequence:CCGGATGCACATAAGTGACTATATACTCGAGTATATAGTCACTTATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1065s21c1
Sequence:CCGGATCACCGACCTGGCATATAATCTCGAGATTATATGCCAGGTCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1253s21c1
Sequence:CCGGATTCCGCAAGAGGATCATAAACTCGAGTTTATGATCCTCTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1171s21c1
Sequence:CCGGGCTATTTGATGCACGAGTTTCCTCGAGGAAACTCGTGCATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-924s1c1
Sequence:CCGGCTTTGCAATTGTGGGCATCAACTCGAGTTGATGCCCACAATTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-942s1c1
Sequence:CCGGCAATATCACCGACCTGGCATACTCGAGTATGCCAGGTCGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177769
ELMOD1 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1218s21c1
Sequence:CCGGATGGACATAATGGAGTTTAATCTCGAGATTAAACTCCATTATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177769.4-1429s21c1
Sequence:CCGGATGCACATAAGTGACTATATACTCGAGTATATAGTCACTTATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1065s21c1
Sequence:CCGGATCACCGACCTGGCATATAATCTCGAGATTATATGCCAGGTCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1253s21c1
Sequence:CCGGATTCCGCAAGAGGATCATAAACTCGAGTTTATGATCCTCTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1171s21c1
Sequence:CCGGGCTATTTGATGCACGAGTTTCCTCGAGGAAACTCGTGCATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-924s1c1
Sequence:CCGGCTTTGCAATTGTGGGCATCAACTCGAGTTGATGCCCACAATTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-942s1c1
Sequence:CCGGCAATATCACCGACCTGGCATACTCGAGTATGCCAGGTCGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177769
ELMOD1 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1218s21c1
Sequence:CCGGATGGACATAATGGAGTTTAATCTCGAGATTAAACTCCATTATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177769.4-1429s21c1
Sequence:CCGGATGCACATAAGTGACTATATACTCGAGTATATAGTCACTTATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1065s21c1
Sequence:CCGGATCACCGACCTGGCATATAATCTCGAGATTATATGCCAGGTCGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1253s21c1
Sequence:CCGGATTCCGCAAGAGGATCATAAACTCGAGTTTATGATCCTCTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177769.4-1171s21c1
Sequence:CCGGGCTATTTGATGCACGAGTTTCCTCGAGGAAACTCGTGCATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-924s1c1
Sequence:CCGGCTTTGCAATTGTGGGCATCAACTCGAGTTGATGCCCACAATTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177769.2-942s1c1
Sequence:CCGGCAATATCACCGACCTGGCATACTCGAGTATGCCAGGTCGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018712
VALIDATED
ELMOD1 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-1128s1c1
Sequence:CCGGCTCGGAAGGTTTAATCAACATCTCGAGATGTTGATTAAACCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-2175s1c1
Sequence:CCGGCCTAAGTGTATGATGCTTGAACTCGAGTTCAAGCATCATACACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-457s1c1
Sequence:CCGGGCTTGCCTTCTGCAAATCGTTCTCGAGAACGATTTGCAGAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018712.2-969s1c1
Sequence:CCGGGCAAACATTCTGCTATTTGATCTCGAGATCAAATAGCAGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1503s1c1
Sequence:CCGGGCTGAATCTCATTCTGTGAAACTCGAGTTTCACAGAATGAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-596s1c1
Sequence:CCGGCACTGGAATCTCGGATTTCTACTCGAGTAGAAATCCGAGATTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1348s1c1
Sequence:CCGGCTGCTCATATTGTGGCATTATCTCGAGATAATGCCACAATATGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-462s1c1
Sequence:CCGGCCTTCTGCAAATCGTTGGGTACTCGAGTACCCAACGATTTGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-345s1c1
Sequence:CCGGGCAGACTTCTGTGAGTGTTCACTCGAGTGAACACTCACAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018712
VALIDATED
ELMOD1 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-1128s1c1
Sequence:CCGGCTCGGAAGGTTTAATCAACATCTCGAGATGTTGATTAAACCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-2175s1c1
Sequence:CCGGCCTAAGTGTATGATGCTTGAACTCGAGTTCAAGCATCATACACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-457s1c1
Sequence:CCGGGCTTGCCTTCTGCAAATCGTTCTCGAGAACGATTTGCAGAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018712.2-969s1c1
Sequence:CCGGGCAAACATTCTGCTATTTGATCTCGAGATCAAATAGCAGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1503s1c1
Sequence:CCGGGCTGAATCTCATTCTGTGAAACTCGAGTTTCACAGAATGAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-596s1c1
Sequence:CCGGCACTGGAATCTCGGATTTCTACTCGAGTAGAAATCCGAGATTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1348s1c1
Sequence:CCGGCTGCTCATATTGTGGCATTATCTCGAGATAATGCCACAATATGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-462s1c1
Sequence:CCGGCCTTCTGCAAATCGTTGGGTACTCGAGTACCCAACGATTTGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-345s1c1
Sequence:CCGGGCAGACTTCTGTGAGTGTTCACTCGAGTGAACACTCACAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018712
VALIDATED
ELMOD1 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-1128s1c1
Sequence:CCGGCTCGGAAGGTTTAATCAACATCTCGAGATGTTGATTAAACCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-2175s1c1
Sequence:CCGGCCTAAGTGTATGATGCTTGAACTCGAGTTCAAGCATCATACACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-457s1c1
Sequence:CCGGGCTTGCCTTCTGCAAATCGTTCTCGAGAACGATTTGCAGAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018712.2-969s1c1
Sequence:CCGGGCAAACATTCTGCTATTTGATCTCGAGATCAAATAGCAGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1503s1c1
Sequence:CCGGGCTGAATCTCATTCTGTGAAACTCGAGTTTCACAGAATGAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-596s1c1
Sequence:CCGGCACTGGAATCTCGGATTTCTACTCGAGTAGAAATCCGAGATTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018712.2-1348s1c1
Sequence:CCGGCTGCTCATATTGTGGCATTATCTCGAGATAATGCCACAATATGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-462s1c1
Sequence:CCGGCCTTCTGCAAATCGTTGGGTACTCGAGTACCCAACGATTTGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018712.2-345s1c1
Sequence:CCGGGCAGACTTCTGTGAGTGTTCACTCGAGTGAACACTCACAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks