EMAIL THIS PAGE TO A FRIEND

ELMOD2

ELMO/CED-12 domain containing 2

76 Gene Product Result for
Synonyms: 9830169G11Rik
UniProtKB ID: Q8IZ81, B2R712, D3DNZ0
Gene ID:
Human(255520) Summary: This gene encodes one of six engulfment and motility (ELMO) domain-containing proteins. This gene is thought to play a role in antiviral responses. Mutations in this gene may be involved in the cause of familial idiopathic pulmonary fibrosis. [provided by RefSeq, Sep 2010]
Mouse(244548) ELMO/CED-12 domain containing 2
Rat(688581) ELMO/CED-12 domain containing 2
Zebrafish(553267) ELMO/CED-12 domain containing 2
domestic cat(101089764) ELMO/CED-12 domain containing 2
dog(476075) ELMO/CED-12 domain containing 2
chicken(422449) ELMO/CED-12 domain containing 2
sheep(101114814) ELMO/CED-12 domain containing 2
domestic guinea pig(100721739) ELMO/CED-12 domain containing 2
naked mole-rat(101722927) ELMO/CED-12 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153702 Rosetta Predictions human pricing
NM_001109506 Rosetta Predictions rat pricing
NM_178736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041337 predicted 596
2 SASI_Hs01_00041340 predicted 641
3 SASI_Hs01_00041341 predicted 775
4 SASI_Hs01_00041342 predicted 939
5 SASI_Hs02_00367418 predicted 454
6 SASI_Hs01_00041343 predicted 343
7 SASI_Hs01_00041346 predicted 498
8 SASI_Hs02_00367419 predicted 297
9 SASI_Hs02_00367420 predicted 686
10 SASI_Hs02_00367421 predicted 936
11 SASI_Hs01_00041338 predicted 843
12 SASI_Hs01_00041339 predicted 615
13 SASI_Hs01_00041344 predicted 805
14 SASI_Hs01_00041345 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249069 predicted 991
2 SASI_Rn02_00249070 predicted 453
3 SASI_Rn02_00249071 predicted 720
4 SASI_Rn02_00249072 predicted 605
5 SASI_Rn02_00249073 predicted 847
6 SASI_Rn02_00249074 predicted 621
7 SASI_Rn02_00249075 predicted 1028
8 SASI_Rn02_00249076 predicted 889
9 SASI_Rn02_00249077 predicted 703
10 SASI_Rn02_00249078 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118342 predicted 672
2 SASI_Mm01_00118343 predicted 567
3 SASI_Mm01_00118344 predicted 1038
4 SASI_Mm01_00118345 predicted 241
5 SASI_Mm01_00118346 predicted 274
6 SASI_Mm01_00118347 predicted 583
7 SASI_Mm01_00118348 predicted 647
8 SASI_Mm02_00349273 predicted 695
9 SASI_Mm01_00118349 predicted 815
10 SASI_Mm01_00118350 predicted 680
11 SASI_Mm01_00118351 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153702
VALIDATED
ELMOD2 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153702.1-1204s1c1
Sequence:CCGGGCGAACTACAGTTTGGAACTTCTCGAGAAGTTCCAAACTGTAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-742s1c1
Sequence:CCGGGCTTACTGAAGAGTGAAGCTTCTCGAGAAGCTTCACTCTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-731s1c1
Sequence:CCGGGATGGCTTATAGCTTACTGAACTCGAGTTCAGTAAGCTATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-453s1c1
Sequence:CCGGGATTCTGATAACCTACAGCATCTCGAGATGCTGTAGGTTATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-146s1c1
Sequence:CCGGGAAATGGCTATTACGACAGATCTCGAGATCTGTCGTAATAGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-596s1c1
Sequence:CCGGCATGGGCATACTTGGGTTAATCTCGAGATTAACCCAAGTATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-511s1c1
Sequence:CCGGCCACGAAGAAGTTAAACGCTACTCGAGTAGCGTTTAACTTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-173s1c1
Sequence:CCGGGAAGTGTGAATTGCAGCGAATCTCGAGATTCGCTGCAATTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-185s1c1
Sequence:CCGGGCAGCGAATATTTGATACCTACTCGAGTAGGTATCAAATATTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-514s1c1
Sequence:CCGGCGAAGAAGTTAAACGCTAGAACTCGAGTTCTAGCGTTTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-660s21c1
Sequence:CCGGCAGATTCTTTCCCGTTCAAATCTCGAGATTTGAACGGGAAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-488s21c1
Sequence:CCGGGAAGCTTTGGAATCTTCTAATCTCGAGATTAGAAGATTCCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-302s21c1
Sequence:CCGGGGACAAATATGTAGATGATATCTCGAGATATCATCTACATATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-690s21c1
Sequence:CCGGTTAGGGTATTCTTATGCAATACTCGAGTATTGCATAAGAATACCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153702.1-1049s21c1
Sequence:CCGGCTGATCAATTACACTCTTATACTCGAGTATAAGAGTGTAATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-388s21c1
Sequence:CCGGTACTGCAGATAACTGGTTATACTCGAGTATAACCAGTTATCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153702
VALIDATED
ELMOD2 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153702.1-1204s1c1
Sequence:CCGGGCGAACTACAGTTTGGAACTTCTCGAGAAGTTCCAAACTGTAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-742s1c1
Sequence:CCGGGCTTACTGAAGAGTGAAGCTTCTCGAGAAGCTTCACTCTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-731s1c1
Sequence:CCGGGATGGCTTATAGCTTACTGAACTCGAGTTCAGTAAGCTATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-453s1c1
Sequence:CCGGGATTCTGATAACCTACAGCATCTCGAGATGCTGTAGGTTATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-146s1c1
Sequence:CCGGGAAATGGCTATTACGACAGATCTCGAGATCTGTCGTAATAGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-596s1c1
Sequence:CCGGCATGGGCATACTTGGGTTAATCTCGAGATTAACCCAAGTATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-511s1c1
Sequence:CCGGCCACGAAGAAGTTAAACGCTACTCGAGTAGCGTTTAACTTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-173s1c1
Sequence:CCGGGAAGTGTGAATTGCAGCGAATCTCGAGATTCGCTGCAATTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-185s1c1
Sequence:CCGGGCAGCGAATATTTGATACCTACTCGAGTAGGTATCAAATATTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-514s1c1
Sequence:CCGGCGAAGAAGTTAAACGCTAGAACTCGAGTTCTAGCGTTTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-660s21c1
Sequence:CCGGCAGATTCTTTCCCGTTCAAATCTCGAGATTTGAACGGGAAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-488s21c1
Sequence:CCGGGAAGCTTTGGAATCTTCTAATCTCGAGATTAGAAGATTCCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-302s21c1
Sequence:CCGGGGACAAATATGTAGATGATATCTCGAGATATCATCTACATATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-690s21c1
Sequence:CCGGTTAGGGTATTCTTATGCAATACTCGAGTATTGCATAAGAATACCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153702.1-1049s21c1
Sequence:CCGGCTGATCAATTACACTCTTATACTCGAGTATAAGAGTGTAATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-388s21c1
Sequence:CCGGTACTGCAGATAACTGGTTATACTCGAGTATAACCAGTTATCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153702
VALIDATED
ELMOD2 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153702.1-1204s1c1
Sequence:CCGGGCGAACTACAGTTTGGAACTTCTCGAGAAGTTCCAAACTGTAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-742s1c1
Sequence:CCGGGCTTACTGAAGAGTGAAGCTTCTCGAGAAGCTTCACTCTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-731s1c1
Sequence:CCGGGATGGCTTATAGCTTACTGAACTCGAGTTCAGTAAGCTATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-453s1c1
Sequence:CCGGGATTCTGATAACCTACAGCATCTCGAGATGCTGTAGGTTATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-146s1c1
Sequence:CCGGGAAATGGCTATTACGACAGATCTCGAGATCTGTCGTAATAGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-596s1c1
Sequence:CCGGCATGGGCATACTTGGGTTAATCTCGAGATTAACCCAAGTATGCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153702.1-511s1c1
Sequence:CCGGCCACGAAGAAGTTAAACGCTACTCGAGTAGCGTTTAACTTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153702.1-173s1c1
Sequence:CCGGGAAGTGTGAATTGCAGCGAATCTCGAGATTCGCTGCAATTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-185s1c1
Sequence:CCGGGCAGCGAATATTTGATACCTACTCGAGTAGGTATCAAATATTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153702.1-514s1c1
Sequence:CCGGCGAAGAAGTTAAACGCTAGAACTCGAGTTCTAGCGTTTAACTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-660s21c1
Sequence:CCGGCAGATTCTTTCCCGTTCAAATCTCGAGATTTGAACGGGAAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-488s21c1
Sequence:CCGGGAAGCTTTGGAATCTTCTAATCTCGAGATTAGAAGATTCCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-302s21c1
Sequence:CCGGGGACAAATATGTAGATGATATCTCGAGATATCATCTACATATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-690s21c1
Sequence:CCGGTTAGGGTATTCTTATGCAATACTCGAGTATTGCATAAGAATACCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153702.1-1049s21c1
Sequence:CCGGCTGATCAATTACACTCTTATACTCGAGTATAAGAGTGTAATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153702.1-388s21c1
Sequence:CCGGTACTGCAGATAACTGGTTATACTCGAGTATAACCAGTTATCTGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178736
VALIDATED
ELMOD2 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-2695s1c1
Sequence:CCGGGCTGTGTTAGTCTTTAACTTTCTCGAGAAAGTTAAAGACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.3-296s1c1
Sequence:CCGGCAGGTGTATAGCGAACATCATCTCGAGATGATGTTCGCTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-1103s1c1
Sequence:CCGGGCGGACAATCAGTGTATGTTTCTCGAGAAACATACACTGATTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.4-600s1c1
Sequence:CCGGGACTGATCAATCTCGTGTATTCTCGAGAATACACGAGATTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-1887s21c1
Sequence:CCGGTCTGGTGTTTCTGGGTAATATCTCGAGATATTACCCAGAAACACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-900s21c1
Sequence:CCGGAGTTTCACGAGCGGATCAAAGCTCGAGCTTTGATCCGCTCGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-601s21c1
Sequence:CCGGACTGATCAATCTCGTGTATTTCTCGAGAAATACACGAGATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-381s21c1
Sequence:CCGGTGCAGATAACTGGCTATAAACCTCGAGGTTTATAGCCAGTTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-650s21c1
Sequence:CCGGCAGATTCTCTCCCGCTCAAATCTCGAGATTTGAGCGGGAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178736
VALIDATED
ELMOD2 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-2695s1c1
Sequence:CCGGGCTGTGTTAGTCTTTAACTTTCTCGAGAAAGTTAAAGACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.3-296s1c1
Sequence:CCGGCAGGTGTATAGCGAACATCATCTCGAGATGATGTTCGCTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-1103s1c1
Sequence:CCGGGCGGACAATCAGTGTATGTTTCTCGAGAAACATACACTGATTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.4-600s1c1
Sequence:CCGGGACTGATCAATCTCGTGTATTCTCGAGAATACACGAGATTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-1887s21c1
Sequence:CCGGTCTGGTGTTTCTGGGTAATATCTCGAGATATTACCCAGAAACACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-900s21c1
Sequence:CCGGAGTTTCACGAGCGGATCAAAGCTCGAGCTTTGATCCGCTCGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-601s21c1
Sequence:CCGGACTGATCAATCTCGTGTATTTCTCGAGAAATACACGAGATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-381s21c1
Sequence:CCGGTGCAGATAACTGGCTATAAACCTCGAGGTTTATAGCCAGTTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-650s21c1
Sequence:CCGGCAGATTCTCTCCCGCTCAAATCTCGAGATTTGAGCGGGAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178736
VALIDATED
ELMOD2 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-2695s1c1
Sequence:CCGGGCTGTGTTAGTCTTTAACTTTCTCGAGAAAGTTAAAGACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.3-296s1c1
Sequence:CCGGCAGGTGTATAGCGAACATCATCTCGAGATGATGTTCGCTATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178736.3-1103s1c1
Sequence:CCGGGCGGACAATCAGTGTATGTTTCTCGAGAAACATACACTGATTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178736.4-600s1c1
Sequence:CCGGGACTGATCAATCTCGTGTATTCTCGAGAATACACGAGATTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-1887s21c1
Sequence:CCGGTCTGGTGTTTCTGGGTAATATCTCGAGATATTACCCAGAAACACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178736.4-900s21c1
Sequence:CCGGAGTTTCACGAGCGGATCAAAGCTCGAGCTTTGATCCGCTCGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-601s21c1
Sequence:CCGGACTGATCAATCTCGTGTATTTCTCGAGAAATACACGAGATTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-381s21c1
Sequence:CCGGTGCAGATAACTGGCTATAAACCTCGAGGTTTATAGCCAGTTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178736.4-650s21c1
Sequence:CCGGCAGATTCTCTCCCGCTCAAATCTCGAGATTTGAGCGGGAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks