EMAIL THIS PAGE TO A FRIEND

ELMOD3

ELMO/CED-12 domain containing 3

74 Gene Product Result for
Synonyms: LST3 RBED1 RBM29
Gene ID:
Mouse(232089) ELMO/CED-12 domain containing 3
Rat(297342) ELMO/CED-12 domain containing 3
naked mole-rat(101707556) ELMO/CED-12 domain containing 3
domestic guinea pig(100729810) ELMO/CED-12 domain containing 3
sheep(101123360) ELMO/CED-12 domain containing 3
domestic cat(101084700) ELMO/CED-12 domain containing 3
cow(535421) ELMO/CED-12 domain containing 3
dog(475771) ELMO/CED-12 domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026431 MISSION® esiRNA esiRNA targeting mouse Elmod3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032213 Rosetta Predictions human pricing
NM_001013087 Rosetta Predictions rat pricing
NM_144917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205785 predicted 313
2 SASI_Hs02_00359509 predicted 990
3 SASI_Hs01_00205787 predicted 1450
4 SASI_Hs01_00205788 predicted 325
5 SASI_Hs01_00205789 predicted 1106
6 SASI_Hs01_00205790 predicted 393
7 SASI_Hs01_00205791 predicted 1127
8 SASI_Hs02_00359510 predicted 1302
9 SASI_Hs02_00359511 predicted 1403
10 SASI_Hs01_00205793 predicted 1475
11 SASI_Hs01_00205786 predicted 1321
12 SASI_Hs01_00205792 predicted 1199
13 SASI_Hs01_00205794 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116058 predicted 636
2 SASI_Rn01_00116059 predicted 724
3 SASI_Rn01_00116061 predicted 988
4 SASI_Rn01_00116062 predicted 304
5 SASI_Rn01_00116063 predicted 982
6 SASI_Rn02_00200727 predicted 388
7 SASI_Rn01_00116064 predicted 722
8 SASI_Rn01_00116065 predicted 953
9 SASI_Rn01_00116066 predicted 325
10 SASI_Rn02_00200728 predicted 1156
11 SASI_Rn01_00116057 predicted 290
12 SASI_Rn01_00116060 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040762 predicted 728
2 SASI_Mm01_00040763 predicted 387
3 SASI_Mm01_00040764 predicted 388
4 SASI_Mm01_00040765 predicted 1133
5 SASI_Mm01_00040766 predicted 283
6 SASI_Mm01_00040767 predicted 406
7 SASI_Mm01_00040768 predicted 958
8 SASI_Mm01_00040769 predicted 830
9 SASI_Mm01_00040770 predicted 1092
10 SASI_Mm01_00040771 predicted 1359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032213
ELMOD3 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032213.4-412s21c1
Sequence:CCGGGCTGGATATTCTCCATCATATCTCGAGATATGATGGAGAATATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1549s21c1
Sequence:CCGGGGACTATTCAAAGTTGCAATTCTCGAGAATTGCAACTTTGAATAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1772s21c1
Sequence:CCGGTGTTGCAGAGTTGGAAGTATTCTCGAGAATACTTCCAACTCTGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-2299s1c1
Sequence:CCGGGCACCAGTGTCTGTGTTGTTACTCGAGTAACAACACAGACACTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1903s1c1
Sequence:CCGGCCGAGATGAATGGAGGCTTAACTCGAGTTAAGCCTCCATTCATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-556s1c1
Sequence:CCGGGCAGCTAATCTCCTTCAGTGACTCGAGTCACTGAAGGAGATTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1904s1c1
Sequence:CCGGCGAGATGAATGGAGGCTTAAACTCGAGTTTAAGCCTCCATTCATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-395s1c1
Sequence:CCGGGAGTTGAAGAACCATGGCATTCTCGAGAATGCCATGGTTCTTCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032213
ELMOD3 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032213.4-412s21c1
Sequence:CCGGGCTGGATATTCTCCATCATATCTCGAGATATGATGGAGAATATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1549s21c1
Sequence:CCGGGGACTATTCAAAGTTGCAATTCTCGAGAATTGCAACTTTGAATAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1772s21c1
Sequence:CCGGTGTTGCAGAGTTGGAAGTATTCTCGAGAATACTTCCAACTCTGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-2299s1c1
Sequence:CCGGGCACCAGTGTCTGTGTTGTTACTCGAGTAACAACACAGACACTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1903s1c1
Sequence:CCGGCCGAGATGAATGGAGGCTTAACTCGAGTTAAGCCTCCATTCATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-556s1c1
Sequence:CCGGGCAGCTAATCTCCTTCAGTGACTCGAGTCACTGAAGGAGATTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1904s1c1
Sequence:CCGGCGAGATGAATGGAGGCTTAAACTCGAGTTTAAGCCTCCATTCATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-395s1c1
Sequence:CCGGGAGTTGAAGAACCATGGCATTCTCGAGAATGCCATGGTTCTTCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032213
ELMOD3 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032213.4-412s21c1
Sequence:CCGGGCTGGATATTCTCCATCATATCTCGAGATATGATGGAGAATATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1549s21c1
Sequence:CCGGGGACTATTCAAAGTTGCAATTCTCGAGAATTGCAACTTTGAATAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032213.4-1772s21c1
Sequence:CCGGTGTTGCAGAGTTGGAAGTATTCTCGAGAATACTTCCAACTCTGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-2299s1c1
Sequence:CCGGGCACCAGTGTCTGTGTTGTTACTCGAGTAACAACACAGACACTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1903s1c1
Sequence:CCGGCCGAGATGAATGGAGGCTTAACTCGAGTTAAGCCTCCATTCATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-556s1c1
Sequence:CCGGGCAGCTAATCTCCTTCAGTGACTCGAGTCACTGAAGGAGATTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032213.3-1904s1c1
Sequence:CCGGCGAGATGAATGGAGGCTTAAACTCGAGTTTAAGCCTCCATTCATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032213.3-395s1c1
Sequence:CCGGGAGTTGAAGAACCATGGCATTCTCGAGAATGCCATGGTTCTTCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144917
VALIDATED
ELMOD3 MISSION shRNA Bacterial Glycerol Stock
ELMO/CED-12 domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1200s21c1
Sequence:CCGGAGACTCAGGCTTTGTCCTCAACTCGAGTTGAGGACAAAGCCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1084s21c1
Sequence:CCGGTGTCTCTCCAGGGAGTGTAATCTCGAGATTACACTCCCTGGAGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1178s21c1
Sequence:CCGGGGACCCAGCAGAAGACTATTTCTCGAGAAATAGTCTTCTGCTGGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1135s21c1
Sequence:CCGGAGCTTCTACGCGGCTACTTTCCTCGAGGAAAGTAGCCGCGTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1217s21c1
Sequence:CCGGTCAAAGACTTGGAAGCGTTGGCTCGAGCCAACGCTTCCAAGTCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-355s1c1
Sequence:CCGGGCTCTCTTCATCGTACAAGGACTCGAGTCCTTGTACGATGAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-531s1c1
Sequence:CCGGCCATCCATCCAGACATAGAGACTCGAGTCTCTATGTCTGGATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144917
VALIDATED
ELMOD3 MISSION shRNA shRNA Plasmid DNA
ELMO/CED-12 domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1200s21c1
Sequence:CCGGAGACTCAGGCTTTGTCCTCAACTCGAGTTGAGGACAAAGCCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1084s21c1
Sequence:CCGGTGTCTCTCCAGGGAGTGTAATCTCGAGATTACACTCCCTGGAGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1178s21c1
Sequence:CCGGGGACCCAGCAGAAGACTATTTCTCGAGAAATAGTCTTCTGCTGGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1135s21c1
Sequence:CCGGAGCTTCTACGCGGCTACTTTCCTCGAGGAAAGTAGCCGCGTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1217s21c1
Sequence:CCGGTCAAAGACTTGGAAGCGTTGGCTCGAGCCAACGCTTCCAAGTCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-355s1c1
Sequence:CCGGGCTCTCTTCATCGTACAAGGACTCGAGTCCTTGTACGATGAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-531s1c1
Sequence:CCGGCCATCCATCCAGACATAGAGACTCGAGTCTCTATGTCTGGATGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144917
VALIDATED
ELMOD3 MISSION shRNA Lentiviral Transduction Particles
ELMO/CED-12 domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1200s21c1
Sequence:CCGGAGACTCAGGCTTTGTCCTCAACTCGAGTTGAGGACAAAGCCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1084s21c1
Sequence:CCGGTGTCTCTCCAGGGAGTGTAATCTCGAGATTACACTCCCTGGAGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1178s21c1
Sequence:CCGGGGACCCAGCAGAAGACTATTTCTCGAGAAATAGTCTTCTGCTGGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1135s21c1
Sequence:CCGGAGCTTCTACGCGGCTACTTTCCTCGAGGAAAGTAGCCGCGTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144917.4-1217s21c1
Sequence:CCGGTCAAAGACTTGGAAGCGTTGGCTCGAGCCAACGCTTCCAAGTCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-355s1c1
Sequence:CCGGGCTCTCTTCATCGTACAAGGACTCGAGTCCTTGTACGATGAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144917.2-531s1c1
Sequence:CCGGCCATCCATCCAGACATAGAGACTCGAGTCTCTATGTCTGGATGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)