EMAIL THIS PAGE TO A FRIEND

ELMSAN1

ELM2 and Myb/SANT-like domain containing 1

293 Gene Product Result for
Synonyms: C14orf117 C14orf43 LSR68 c14_5541
UniProtKB ID: Q6PJG2, Q6PK13, Q6PK59, Q6ZS23
Gene ID:
Mouse(238317) ELM2 and Myb/SANT-like domain containing 1
Rat(314306) ELM2 and Myb/SANT-like domain containing 1
domestic cat(101088760) ELM2 and Myb/SANT-like domain containing 1
cow(505848) ELM2 and Myb/SANT-like domain containing 1
dog(490775) ELM2 and Myb/SANT-like domain containing 1
sheep(101105164) ELM2 and Myb/SANT-like domain containing 1
domestic guinea pig(100720355) ELM2 and Myb/SANT-like domain containing 1
naked mole-rat(101707402) ELM2 and Myb/SANT-like domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003111 Anti-ELMSAN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001473233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001473233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001473233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118591 MISSION® esiRNA esiRNA human C14orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001043318 Rosetta Predictions human pricing
NM_194278 Rosetta Predictions human pricing
XM_001057760 Rosetta Predictions rat pricing
XM_001057823 Rosetta Predictions rat pricing
XM_001057875 Rosetta Predictions rat pricing
XM_234404 Rosetta Predictions rat pricing
XM_001473233 Rosetta Predictions mouse pricing
XM_001477247 Rosetta Predictions mouse pricing
XM_138091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311251 predicted 746
2 SASI_Hs02_00311252 predicted 2731
3 SASI_Hs02_00311253 predicted 2731
4 SASI_Hs02_00311254 predicted 749
5 SASI_Hs02_00311255 predicted 1634
6 SASI_Hs02_00311256 predicted 2874
7 SASI_Hs02_00311257 predicted 2800
8 SASI_Hs02_00311258 predicted 1820
9 SASI_Hs02_00311259 predicted 2014
10 SASI_Hs02_00311260 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086600 predicted 1184
2 SASI_Hs01_00086601 predicted 3176
3 SASI_Hs02_00371388 predicted 3173
4 SASI_Hs02_00371389 predicted 1187
5 SASI_Hs02_00371390 predicted 2079
6 SASI_Hs01_00086603 predicted 3310
7 SASI_Hs01_00086604 predicted 3238
8 SASI_Hs01_00086605 predicted 2258
9 SASI_Hs01_00086606 predicted 2452
10 SASI_Hs01_00086608 predicted 2240
11 SASI_Hs01_00086602 predicted 3095
12 SASI_Hs01_00086607 predicted 2779
13 SASI_Hs01_00086609 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287489 predicted 1055
2 SASI_Rn02_00287490 predicted 2519
3 SASI_Rn02_00287491 predicted 2385
4 SASI_Rn02_00287492 predicted 1475
5 SASI_Rn02_00287493 predicted 1759
6 SASI_Rn02_00287494 predicted 2595
7 SASI_Rn02_00287495 predicted 2445
8 SASI_Rn02_00287496 predicted 1885
9 SASI_Rn02_00287497 predicted 517
10 SASI_Rn02_00287498 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287676 predicted 1404
2 SASI_Rn02_00287677 predicted 2851
3 SASI_Rn02_00287678 predicted 3426
4 SASI_Rn02_00287679 predicted 2722
5 SASI_Rn02_00287680 predicted 372
6 SASI_Rn02_00287681 predicted 3511
7 SASI_Rn02_00287682 predicted 1816
8 SASI_Rn02_00287683 predicted 2089
9 SASI_Rn02_00287684 predicted 2777
10 SASI_Rn02_00287685 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287806 predicted 1820
2 SASI_Rn02_00287807 predicted 3266
3 SASI_Rn02_00287808 predicted 3835
4 SASI_Rn02_00287809 predicted 3129
5 SASI_Rn02_00287810 predicted 778
6 SASI_Rn02_00287811 predicted 3923
7 SASI_Rn02_00287812 predicted 2222
8 SASI_Rn02_00287813 predicted 2505
9 SASI_Rn02_00287814 predicted 3189
10 SASI_Rn02_00287815 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388459 predicted 1821
2 SASI_Rn02_00388460 predicted 3269
3 SASI_Rn02_00388461 predicted 3833
4 SASI_Rn02_00388462 predicted 3131
5 SASI_Rn02_00388463 predicted 777
6 SASI_Rn02_00388464 predicted 3924
7 SASI_Rn02_00388465 predicted 2231
8 SASI_Rn02_00388466 predicted 2508
9 SASI_Rn02_00388467 predicted 3188
10 SASI_Rn02_00388468 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366838 predicted 2828
2 SASI_Mm02_00366839 predicted 1416
3 SASI_Mm02_00366840 predicted 375
4 SASI_Mm02_00366841 predicted 1385
5 SASI_Mm02_00366842 predicted 1749
6 SASI_Mm02_00366843 predicted 1167
7 SASI_Mm02_00366844 predicted 1997
8 SASI_Mm02_00366845 predicted 1451
9 SASI_Mm02_00366846 predicted 625
10 SASI_Mm02_00366847 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394490 predicted 2826
2 SASI_Mm02_00394491 predicted 1409
3 SASI_Mm02_00394492 predicted 374
4 SASI_Mm02_00394493 predicted 1388
5 SASI_Mm02_00394494 predicted 1750
6 SASI_Mm02_00394495 predicted 1167
7 SASI_Mm02_00394496 predicted 1996
8 SASI_Mm02_00394497 predicted 1454
9 SASI_Mm02_00394498 predicted 628
10 SASI_Mm02_00394499 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252051 predicted 817
2 SASI_Mm01_00252052 predicted 1829
3 SASI_Mm01_00252053 predicted 3692
4 SASI_Mm01_00252054 predicted 1603
5 SASI_Mm01_00252055 predicted 3380
6 SASI_Mm01_00252056 predicted 1890
7 SASI_Mm01_00252057 predicted 3361
8 SASI_Mm01_00252058 predicted 1066
9 SASI_Mm01_00252059 predicted 2205
10 SASI_Mm01_00252060 predicted 3478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194278
VALIDATED
ELMSAN1 MISSION shRNA Bacterial Glycerol Stock
ELM2 and Myb/SANT-like domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194278.2-2777s1c1
Sequence:CCGGCCTCTACTTCAATGCCATCATCTCGAGATGATGGCATTGAAGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3866s1c1
Sequence:CCGGCCAGAATCAGGAGAACACTTTCTCGAGAAAGTGTTCTCCTGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3851s1c1
Sequence:CCGGGACATTCAGTAAGACCCAGAACTCGAGTTCTGGGTCTTACTGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3293s1c1
Sequence:CCGGGTTCAACAAAGGCATTGCCATCTCGAGATGGCAATGCCTTTGTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2874s21c1
Sequence:CCGGGACTAACAGTGCTGAAGTAACCTCGAGGTTACTTCAGCACTGTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3487s21c1
Sequence:CCGGGAGGTTGAAGTGGATATTAAGCTCGAGCTTAATATCCACTTCAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4030s21c1
Sequence:CCGGTGGTTGGCTCAGCGGGTTTCTCTCGAGAGAAACCCGCTGAGCCAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1311s21c1
Sequence:CCGGCCGCTATGTGCGACCAATGATCTCGAGATCATTGGTCGCACATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1382s21c1
Sequence:CCGGCTTTCCACGCAGCCAAGAAACCTCGAGGTTTCTTGGCTGCGTGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1900s21c1
Sequence:CCGGGGCAACCTGTTCCTACATCACCTCGAGGTGATGTAGGAACAGGTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4015s21c1
Sequence:CCGGTGTCCGCCTCGTTTCTGGTTGCTCGAGCAACCAGAAACGAGGCGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3239s21c1
Sequence:CCGGACCATCCGCTGGCAACTTATCCTCGAGGATAAGTTGCCAGCGGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3388s21c1
Sequence:CCGGGAGTTCTACTACACCTACAAGCTCGAGCTTGTAGGTGTAGTAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2266s21c1
Sequence:CCGGGTATTGGCCTCAACTACCAAGCTCGAGCTTGGTAGTTGAGGCCAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194278
VALIDATED
ELMSAN1 MISSION shRNA shRNA Plasmid DNA
ELM2 and Myb/SANT-like domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194278.2-2777s1c1
Sequence:CCGGCCTCTACTTCAATGCCATCATCTCGAGATGATGGCATTGAAGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3866s1c1
Sequence:CCGGCCAGAATCAGGAGAACACTTTCTCGAGAAAGTGTTCTCCTGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3851s1c1
Sequence:CCGGGACATTCAGTAAGACCCAGAACTCGAGTTCTGGGTCTTACTGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3293s1c1
Sequence:CCGGGTTCAACAAAGGCATTGCCATCTCGAGATGGCAATGCCTTTGTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2874s21c1
Sequence:CCGGGACTAACAGTGCTGAAGTAACCTCGAGGTTACTTCAGCACTGTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3487s21c1
Sequence:CCGGGAGGTTGAAGTGGATATTAAGCTCGAGCTTAATATCCACTTCAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4030s21c1
Sequence:CCGGTGGTTGGCTCAGCGGGTTTCTCTCGAGAGAAACCCGCTGAGCCAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1311s21c1
Sequence:CCGGCCGCTATGTGCGACCAATGATCTCGAGATCATTGGTCGCACATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1382s21c1
Sequence:CCGGCTTTCCACGCAGCCAAGAAACCTCGAGGTTTCTTGGCTGCGTGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1900s21c1
Sequence:CCGGGGCAACCTGTTCCTACATCACCTCGAGGTGATGTAGGAACAGGTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4015s21c1
Sequence:CCGGTGTCCGCCTCGTTTCTGGTTGCTCGAGCAACCAGAAACGAGGCGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3239s21c1
Sequence:CCGGACCATCCGCTGGCAACTTATCCTCGAGGATAAGTTGCCAGCGGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3388s21c1
Sequence:CCGGGAGTTCTACTACACCTACAAGCTCGAGCTTGTAGGTGTAGTAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2266s21c1
Sequence:CCGGGTATTGGCCTCAACTACCAAGCTCGAGCTTGGTAGTTGAGGCCAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194278
VALIDATED
ELMSAN1 MISSION shRNA Lentiviral Transduction Particles
ELM2 and Myb/SANT-like domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194278.2-2777s1c1
Sequence:CCGGCCTCTACTTCAATGCCATCATCTCGAGATGATGGCATTGAAGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3866s1c1
Sequence:CCGGCCAGAATCAGGAGAACACTTTCTCGAGAAAGTGTTCTCCTGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3851s1c1
Sequence:CCGGGACATTCAGTAAGACCCAGAACTCGAGTTCTGGGTCTTACTGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194278.2-3293s1c1
Sequence:CCGGGTTCAACAAAGGCATTGCCATCTCGAGATGGCAATGCCTTTGTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2874s21c1
Sequence:CCGGGACTAACAGTGCTGAAGTAACCTCGAGGTTACTTCAGCACTGTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3487s21c1
Sequence:CCGGGAGGTTGAAGTGGATATTAAGCTCGAGCTTAATATCCACTTCAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4030s21c1
Sequence:CCGGTGGTTGGCTCAGCGGGTTTCTCTCGAGAGAAACCCGCTGAGCCAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1311s21c1
Sequence:CCGGCCGCTATGTGCGACCAATGATCTCGAGATCATTGGTCGCACATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1382s21c1
Sequence:CCGGCTTTCCACGCAGCCAAGAAACCTCGAGGTTTCTTGGCTGCGTGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-1900s21c1
Sequence:CCGGGGCAACCTGTTCCTACATCACCTCGAGGTGATGTAGGAACAGGTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194278.3-4015s21c1
Sequence:CCGGTGTCCGCCTCGTTTCTGGTTGCTCGAGCAACCAGAAACGAGGCGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3239s21c1
Sequence:CCGGACCATCCGCTGGCAACTTATCCTCGAGGATAAGTTGCCAGCGGATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-3388s21c1
Sequence:CCGGGAGTTCTACTACACCTACAAGCTCGAGCTTGTAGGTGTAGTAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194278.3-2266s21c1
Sequence:CCGGGTATTGGCCTCAACTACCAAGCTCGAGCTTGGTAGTTGAGGCCAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001473233
ELMSAN1 MISSION shRNA Bacterial Glycerol Stock
ELM2 and Myb/SANT-like domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2335s21c1
Sequence:CCGGCTACTTCAATGCCATCATATCCTCGAGGATATGATGGCATTGAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2731s21c1
Sequence:CCGGCATCCTGGAGGCGCTGAATAACTCGAGTTATTCAGCGCCTCCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-1714s21c1
Sequence:CCGGGGTGTCCCAGGAGGCTAATTTCTCGAGAAATTAGCCTCCTGGGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2784s21c1
Sequence:CCGGATCACCCACTGGCGACATATCCTCGAGGATATGTCGCCAGTGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001473233
ELMSAN1 MISSION shRNA shRNA Plasmid DNA
ELM2 and Myb/SANT-like domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2335s21c1
Sequence:CCGGCTACTTCAATGCCATCATATCCTCGAGGATATGATGGCATTGAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2731s21c1
Sequence:CCGGCATCCTGGAGGCGCTGAATAACTCGAGTTATTCAGCGCCTCCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-1714s21c1
Sequence:CCGGGGTGTCCCAGGAGGCTAATTTCTCGAGAAATTAGCCTCCTGGGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2784s21c1
Sequence:CCGGATCACCCACTGGCGACATATCCTCGAGGATATGTCGCCAGTGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001473233
ELMSAN1 MISSION shRNA Lentiviral Transduction Particles
ELM2 and Myb/SANT-like domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2335s21c1
Sequence:CCGGCTACTTCAATGCCATCATATCCTCGAGGATATGATGGCATTGAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2731s21c1
Sequence:CCGGCATCCTGGAGGCGCTGAATAACTCGAGTTATTCAGCGCCTCCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-1714s21c1
Sequence:CCGGGGTGTCCCAGGAGGCTAATTTCTCGAGAAATTAGCCTCCTGGGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473233.1-2784s21c1
Sequence:CCGGATCACCCACTGGCGACATATCCTCGAGGATATGTCGCCAGTGGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)