EMAIL THIS PAGE TO A FRIEND

ELN

elastin

215 Gene Product Result for
Synonyms: SVAS WBS WS
Gene ID:
Human(2006) Summary: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13717) elastin
Rat(25043) elastin
chicken(396441) elastin (supravalvular aortic stenosis, Williams-Beuren syndrome)
cow(280781) elastin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0136 AQUA Peptide LPGGYGLPYTTG[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000501 Rosetta Predictions human pricing
NM_001081752 Rosetta Predictions human pricing
NM_001081753 Rosetta Predictions human pricing
NM_001081754 Rosetta Predictions human pricing
NM_001081755 Rosetta Predictions human pricing
NM_012722 Rosetta Predictions rat pricing
NM_007925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302669 predicted 2568
2 SASI_Hs02_00302670 predicted 2402
3 SASI_Hs01_00219826 predicted 1077
4 SASI_Hs02_00302671 predicted 2566
5 SASI_Hs02_00302672 predicted 1103
6 SASI_Hs02_00302673 predicted 1212
7 SASI_Hs02_00302674 predicted 2556
8 SASI_Hs01_00219831 predicted 1203
9 SASI_Hs02_00302675 predicted 1107
10 SASI_Hs02_00302676 predicted 2382
11 SASI_Hs01_00219827 predicted 346
12 SASI_Hs01_00219828 predicted 1398
13 SASI_Hs01_00219829 predicted 1551
14 SASI_Hs01_00219830 predicted 1383
15 SASI_Hs01_00219832 predicted 1207
16 SASI_Hs01_00219833 predicted 1402
17 SASI_Hs01_00219834 predicted 1382
18 SASI_Hs01_00219835 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316553 predicted 2429
2 SASI_Hs02_00316554 predicted 2259
3 SASI_Hs02_00316555 predicted 1051
4 SASI_Hs02_00316556 predicted 2424
5 SASI_Hs02_00316557 predicted 1073
6 SASI_Hs02_00316558 predicted 1185
7 SASI_Hs02_00316559 predicted 2423
8 SASI_Hs02_00316560 predicted 1170
9 SASI_Hs02_00316561 predicted 1080
10 SASI_Hs02_00316562 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316563 predicted 2469
2 SASI_Hs02_00316564 predicted 2301
3 SASI_Hs02_00316565 predicted 1097
4 SASI_Hs02_00316566 predicted 2474
5 SASI_Hs02_00316567 predicted 1119
6 SASI_Hs02_00316568 predicted 1231
7 SASI_Hs02_00316569 predicted 2462
8 SASI_Hs02_00316570 predicted 1220
9 SASI_Hs02_00316571 predicted 1125
10 SASI_Hs02_00316572 predicted 2289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316573 predicted 2531
2 SASI_Hs02_00316574 predicted 2362
3 SASI_Hs02_00316575 predicted 1098
4 SASI_Hs02_00316576 predicted 2535
5 SASI_Hs02_00316577 predicted 1118
6 SASI_Hs02_00316578 predicted 1231
7 SASI_Hs02_00316579 predicted 2522
8 SASI_Hs02_00316580 predicted 1222
9 SASI_Hs02_00316581 predicted 1121
10 SASI_Hs02_00316582 predicted 2347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316583 predicted 2508
2 SASI_Hs02_00316584 predicted 2348
3 SASI_Hs02_00316585 predicted 1077
4 SASI_Hs02_00316586 predicted 2517
5 SASI_Hs02_00316587 predicted 1108
6 SASI_Hs02_00316588 predicted 1213
7 SASI_Hs02_00316589 predicted 2507
8 SASI_Hs02_00316590 predicted 1203
9 SASI_Hs02_00316591 predicted 1104
10 SASI_Hs02_00316592 predicted 2329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059735 predicted 1108
2 SASI_Rn01_00059736 predicted 1332
3 SASI_Rn01_00059737 predicted 1757
4 SASI_Rn02_00260059 predicted 931
5 SASI_Rn01_00059738 predicted 574
6 SASI_Rn01_00059739 predicted 356
7 SASI_Rn01_00059740 predicted 2476
8 SASI_Rn01_00059742 predicted 1457
9 SASI_Rn01_00059743 predicted 2469
10 SASI_Rn01_00059744 predicted 217
11 SASI_Rn01_00059741 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174019 predicted 2884
2 SASI_Mm01_00174020 predicted 870
3 SASI_Mm01_00174021 predicted 608
4 SASI_Mm02_00312754 predicted 1296
5 SASI_Mm01_00174022 predicted 2622
6 SASI_Mm01_00174023 predicted 2868
7 SASI_Mm01_00174024 predicted 1120
8 SASI_Mm01_00174025 predicted 366
9 SASI_Mm01_00174026 predicted 953
10 SASI_Mm01_00174027 predicted 2879
11 SASI_Mm01_00174018 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000501
VALIDATED
ELN MISSION shRNA Bacterial Glycerol Stock
elastin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-762s21c1
Sequence:CCGGGGAAACTGCCCTATGGCTATGCTCGAGCATAGCCATAGGGCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-2196s21c1
Sequence:CCGGGCTTCGGATTGTCTCCCATTTCTCGAGAAATGGGAGACAATCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2298s21c1
Sequence:CCGGCAACGTTGGTGCTACTGCTTGCTCGAGCAAGCAGTAGCACCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2571s21c1
Sequence:CCGGCACGCTGGTGCTCTTATCTTCCTCGAGGAAGATAAGAGCACCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1863s1c1
Sequence:CCGGTGCCGCTAAAGCAGCCAAATACTCGAGTATTTGGCTGCTTTAGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-400s1c1
Sequence:CCGGGCCGGAGTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1864s1c1
Sequence:CCGGGCCGCTAAAGCAGCCAAATATCTCGAGATATTTGGCTGCTTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000501.1-1381s1c1
Sequence:CCGGGCTGCTAAAGCAGCCGCCAAACTCGAGTTTGGCGGCTGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000501
VALIDATED
ELN MISSION shRNA shRNA Plasmid DNA
elastin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-762s21c1
Sequence:CCGGGGAAACTGCCCTATGGCTATGCTCGAGCATAGCCATAGGGCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-2196s21c1
Sequence:CCGGGCTTCGGATTGTCTCCCATTTCTCGAGAAATGGGAGACAATCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2298s21c1
Sequence:CCGGCAACGTTGGTGCTACTGCTTGCTCGAGCAAGCAGTAGCACCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2571s21c1
Sequence:CCGGCACGCTGGTGCTCTTATCTTCCTCGAGGAAGATAAGAGCACCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1863s1c1
Sequence:CCGGTGCCGCTAAAGCAGCCAAATACTCGAGTATTTGGCTGCTTTAGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-400s1c1
Sequence:CCGGGCCGGAGTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1864s1c1
Sequence:CCGGGCCGCTAAAGCAGCCAAATATCTCGAGATATTTGGCTGCTTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000501.1-1381s1c1
Sequence:CCGGGCTGCTAAAGCAGCCGCCAAACTCGAGTTTGGCGGCTGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000501
VALIDATED
ELN MISSION shRNA Lentiviral Transduction Particles
elastin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-762s21c1
Sequence:CCGGGGAAACTGCCCTATGGCTATGCTCGAGCATAGCCATAGGGCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000501.2-2196s21c1
Sequence:CCGGGCTTCGGATTGTCTCCCATTTCTCGAGAAATGGGAGACAATCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2298s21c1
Sequence:CCGGCAACGTTGGTGCTACTGCTTGCTCGAGCAAGCAGTAGCACCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000501.2-2571s21c1
Sequence:CCGGCACGCTGGTGCTCTTATCTTCCTCGAGGAAGATAAGAGCACCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1863s1c1
Sequence:CCGGTGCCGCTAAAGCAGCCAAATACTCGAGTATTTGGCTGCTTTAGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-400s1c1
Sequence:CCGGGCCGGAGTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000501.1-1864s1c1
Sequence:CCGGGCCGCTAAAGCAGCCAAATATCTCGAGATATTTGGCTGCTTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000501.1-1381s1c1
Sequence:CCGGGCTGCTAAAGCAGCCGCCAAACTCGAGTTTGGCGGCTGCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007925
ELN MISSION shRNA Bacterial Glycerol Stock
elastin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-1449s21c1
Sequence:CCGGCCGCCAAAGCTGCTAAGTATGCTCGAGCATACTTAGCAGCTTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-137s21c1
Sequence:CCGGGTTCCCGGTGGAGTCTATTATCTCGAGATAATAGACTCCACCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007925.2-3197s1c1
Sequence:CCGGGCTCCCTTGTTCTTATGGAATCTCGAGATTCCATAAGAACAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-2007s1c1
Sequence:CCGGGCTGCATCCAAAGCTGCTAAACTCGAGTTTAGCAGCTTTGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-375s1c1
Sequence:CCGGGCTTATAAAGCTGCCGCCAAACTCGAGTTTGGCGGCAGCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-960s1c1
Sequence:CCGGGCAGCTAAAGCAGCCAAGTATCTCGAGATACTTGGCTGCTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-810s1c1
Sequence:CCGGCCACTGGGTTATCCCATCAAACTCGAGTTTGATGGGATAACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007925
ELN MISSION shRNA shRNA Plasmid DNA
elastin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-1449s21c1
Sequence:CCGGCCGCCAAAGCTGCTAAGTATGCTCGAGCATACTTAGCAGCTTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-137s21c1
Sequence:CCGGGTTCCCGGTGGAGTCTATTATCTCGAGATAATAGACTCCACCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007925.2-3197s1c1
Sequence:CCGGGCTCCCTTGTTCTTATGGAATCTCGAGATTCCATAAGAACAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-2007s1c1
Sequence:CCGGGCTGCATCCAAAGCTGCTAAACTCGAGTTTAGCAGCTTTGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-375s1c1
Sequence:CCGGGCTTATAAAGCTGCCGCCAAACTCGAGTTTGGCGGCAGCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-960s1c1
Sequence:CCGGGCAGCTAAAGCAGCCAAGTATCTCGAGATACTTGGCTGCTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-810s1c1
Sequence:CCGGCCACTGGGTTATCCCATCAAACTCGAGTTTGATGGGATAACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007925
ELN MISSION shRNA Lentiviral Transduction Particles
elastin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-1449s21c1
Sequence:CCGGCCGCCAAAGCTGCTAAGTATGCTCGAGCATACTTAGCAGCTTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007925.3-137s21c1
Sequence:CCGGGTTCCCGGTGGAGTCTATTATCTCGAGATAATAGACTCCACCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007925.2-3197s1c1
Sequence:CCGGGCTCCCTTGTTCTTATGGAATCTCGAGATTCCATAAGAACAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-2007s1c1
Sequence:CCGGGCTGCATCCAAAGCTGCTAAACTCGAGTTTAGCAGCTTTGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-375s1c1
Sequence:CCGGGCTTATAAAGCTGCCGCCAAACTCGAGTTTGGCGGCAGCTTTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-960s1c1
Sequence:CCGGGCAGCTAAAGCAGCCAAGTATCTCGAGATACTTGGCTGCTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007925.2-810s1c1
Sequence:CCGGCCACTGGGTTATCCCATCAAACTCGAGTTTGATGGGATAACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks