EMAIL THIS PAGE TO A FRIEND

ELOF1

elongation factor 1 homolog (S. cerevisiae)

113 Gene Product Result for
Synonyms: ELF1
UniProtKB ID: P60002, Q8R1J7, Q96II4
Gene ID:
Mouse(66126) elongation factor 1 homolog (ELF1, S. cerevisiae)
Rat(691193) elongation factor 1 homolog (S. cerevisiae)
Zebrafish(393357) elongation factor 1 homolog (S. cerevisiae)
cow(100125945) elongation factor 1 homolog (S. cerevisiae)
domestic cat(101100282) elongation factor 1 homolog (S. cerevisiae)
dog(100687887) elongation factor 1 homolog (S. cerevisiae)
sheep(101120572) elongation factor 1 homolog (S. cerevisiae)
domestic guinea pig(100722299) elongation factor 1 homolog (S. cerevisiae)
naked mole-rat(101717517) elongation factor 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032377 Rosetta Predictions human pricing
NM_001126098 Rosetta Predictions rat pricing
NM_170777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162906 predicted 782
2 SASI_Hs01_00162907 predicted 729
3 SASI_Hs01_00162910 predicted 780
4 SASI_Hs01_00162911 predicted 200
5 SASI_Hs01_00162912 predicted 193
6 SASI_Hs01_00162913 predicted 727
7 SASI_Hs01_00162914 predicted 792
8 SASI_Hs01_00162915 predicted 736
9 SASI_Hs01_00162908 predicted 774
10 SASI_Hs02_00359765 predicted 200
11 SASI_Hs01_00162909 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252993 predicted 367
2 SASI_Rn02_00252994 predicted 601
3 SASI_Rn02_00252995 predicted 871
4 SASI_Rn02_00252996 predicted 512
5 SASI_Rn02_00252997 predicted 597
6 SASI_Rn02_00252998 predicted 773
7 SASI_Rn02_00252999 predicted 736
8 SASI_Rn02_00253000 predicted 326
9 SASI_Rn02_00253001 predicted 451
10 SASI_Rn02_00253002 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126837 predicted 711
2 SASI_Mm01_00126838 predicted 244
3 SASI_Mm01_00126839 predicted 431
4 SASI_Mm01_00126840 predicted 584
5 SASI_Mm01_00126842 predicted 786
6 SASI_Mm01_00126843 predicted 307
7 SASI_Mm01_00126844 predicted 430
8 SASI_Mm01_00126845 predicted 424
9 SASI_Mm02_00343629 predicted 397
10 SASI_Mm01_00126846 predicted 539
11 SASI_Mm01_00126841 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170777
VALIDATED
ELOF1 MISSION shRNA Bacterial Glycerol Stock
elongation factor 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-717s1c1
Sequence:CCGGCCTTTGAGTTGCTCCCATCTTCTCGAGAAGATGGGAGCAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-339s1c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-476s1c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-424s1c1
Sequence:CCGGCCCATCACATACCTGTCAGAACTCGAGTTCTGACAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-369s1c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-488s21c1
Sequence:CCGGCCAATCAGTAGCAAAGTCAGGCTCGAGCCTGACTTTGCTACTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-476s21c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-339s21c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-369s21c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-380s21c1
Sequence:CCGGCTGGAGTCATCTCCTGTACTGCTCGAGCAGTACAGGAGATGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170777
VALIDATED
ELOF1 MISSION shRNA shRNA Plasmid DNA
elongation factor 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-717s1c1
Sequence:CCGGCCTTTGAGTTGCTCCCATCTTCTCGAGAAGATGGGAGCAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-339s1c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-476s1c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-424s1c1
Sequence:CCGGCCCATCACATACCTGTCAGAACTCGAGTTCTGACAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-369s1c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-488s21c1
Sequence:CCGGCCAATCAGTAGCAAAGTCAGGCTCGAGCCTGACTTTGCTACTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-476s21c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-339s21c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-369s21c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-380s21c1
Sequence:CCGGCTGGAGTCATCTCCTGTACTGCTCGAGCAGTACAGGAGATGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170777
VALIDATED
ELOF1 MISSION shRNA Lentiviral Transduction Particles
elongation factor 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-717s1c1
Sequence:CCGGCCTTTGAGTTGCTCCCATCTTCTCGAGAAGATGGGAGCAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-339s1c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-476s1c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-424s1c1
Sequence:CCGGCCCATCACATACCTGTCAGAACTCGAGTTCTGACAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170777.3-369s1c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-488s21c1
Sequence:CCGGCCAATCAGTAGCAAAGTCAGGCTCGAGCCTGACTTTGCTACTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-476s21c1
Sequence:CCGGCCTGCGAGGCAGCCAATCAGTCTCGAGACTGATTGGCTGCCTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-339s21c1
Sequence:CCGGCGAGAAGTCTTGTGATGTGAACTCGAGTTCACATCACAAGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-369s21c1
Sequence:CCGGTGCTCGAAACACTGGAGTCATCTCGAGATGACTCCAGTGTTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170777.3-380s21c1
Sequence:CCGGCTGGAGTCATCTCCTGTACTGCTCGAGCAGTACAGGAGATGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032377
ELOF1 MISSION shRNA Bacterial Glycerol Stock
elongation factor 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-50s1c1
Sequence:CCGGCCTCCCAAGAAGAAGATGACACTCGAGTGTCATCTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-54s1c1
Sequence:CCGGCCAAGAAGAAGATGACAGGCACTCGAGTGCCTGTCATCTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-196s1c1
Sequence:CCGGGCCCATAACGTATCTGTCAGACTCGAGTCTGACAGATACGTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-224s1c1
Sequence:CCGGGATGTGTACAGTGATTGGATACTCGAGTATCCAATCACTGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-113s1c1
Sequence:CCGGGAGAAATCCTGTGATGTGAAACTCGAGTTTCACATCACAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-198s1c1
Sequence:CCGGCCATAACGTATCTGTCAGAACCTCGAGGTTCTGACAGATACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-112s1c1
Sequence:CCGGCGAGAAATCCTGTGATGTGAACTCGAGTTCACATCACAGGATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-197s1c1
Sequence:CCGGCCCATAACGTATCTGTCAGAACTCGAGTTCTGACAGATACGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-106s1c1
Sequence:CCGGCAACCACGAGAAATCCTGTGACTCGAGTCACAGGATTTCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032377.3-613s21c1
Sequence:CCGGGATCTCACTTGGCTCCGAAAGCTCGAGCTTTCGGAGCCAAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-196s21c1
Sequence:CCGGCACCGGAGTCATCTCTTGTACCTCGAGGTACAAGAGATGACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-265s21c1
Sequence:CCGGCGTGGATGTGTACAGTGATTGCTCGAGCAATCACTGTACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-234s21c1
Sequence:CCGGTCCAGACGCCCATAACGTATCCTCGAGGATACGTTATGGGCGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-144s21c1
Sequence:CCGGCCTTCTGCAACCACGAGAAATCTCGAGATTTCTCGTGGTTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032377
ELOF1 MISSION shRNA shRNA Plasmid DNA
elongation factor 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-50s1c1
Sequence:CCGGCCTCCCAAGAAGAAGATGACACTCGAGTGTCATCTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-54s1c1
Sequence:CCGGCCAAGAAGAAGATGACAGGCACTCGAGTGCCTGTCATCTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-196s1c1
Sequence:CCGGGCCCATAACGTATCTGTCAGACTCGAGTCTGACAGATACGTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-224s1c1
Sequence:CCGGGATGTGTACAGTGATTGGATACTCGAGTATCCAATCACTGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-113s1c1
Sequence:CCGGGAGAAATCCTGTGATGTGAAACTCGAGTTTCACATCACAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-198s1c1
Sequence:CCGGCCATAACGTATCTGTCAGAACCTCGAGGTTCTGACAGATACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-112s1c1
Sequence:CCGGCGAGAAATCCTGTGATGTGAACTCGAGTTCACATCACAGGATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-197s1c1
Sequence:CCGGCCCATAACGTATCTGTCAGAACTCGAGTTCTGACAGATACGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-106s1c1
Sequence:CCGGCAACCACGAGAAATCCTGTGACTCGAGTCACAGGATTTCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032377.3-613s21c1
Sequence:CCGGGATCTCACTTGGCTCCGAAAGCTCGAGCTTTCGGAGCCAAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-196s21c1
Sequence:CCGGCACCGGAGTCATCTCTTGTACCTCGAGGTACAAGAGATGACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-265s21c1
Sequence:CCGGCGTGGATGTGTACAGTGATTGCTCGAGCAATCACTGTACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-234s21c1
Sequence:CCGGTCCAGACGCCCATAACGTATCCTCGAGGATACGTTATGGGCGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-144s21c1
Sequence:CCGGCCTTCTGCAACCACGAGAAATCTCGAGATTTCTCGTGGTTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032377
ELOF1 MISSION shRNA Lentiviral Transduction Particles
elongation factor 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-50s1c1
Sequence:CCGGCCTCCCAAGAAGAAGATGACACTCGAGTGTCATCTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-54s1c1
Sequence:CCGGCCAAGAAGAAGATGACAGGCACTCGAGTGCCTGTCATCTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-196s1c1
Sequence:CCGGGCCCATAACGTATCTGTCAGACTCGAGTCTGACAGATACGTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-224s1c1
Sequence:CCGGGATGTGTACAGTGATTGGATACTCGAGTATCCAATCACTGTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-113s1c1
Sequence:CCGGGAGAAATCCTGTGATGTGAAACTCGAGTTTCACATCACAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-198s1c1
Sequence:CCGGCCATAACGTATCTGTCAGAACCTCGAGGTTCTGACAGATACGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-112s1c1
Sequence:CCGGCGAGAAATCCTGTGATGTGAACTCGAGTTCACATCACAGGATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-197s1c1
Sequence:CCGGCCCATAACGTATCTGTCAGAACTCGAGTTCTGACAGATACGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032377.2-106s1c1
Sequence:CCGGCAACCACGAGAAATCCTGTGACTCGAGTCACAGGATTTCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032377.3-613s21c1
Sequence:CCGGGATCTCACTTGGCTCCGAAAGCTCGAGCTTTCGGAGCCAAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-196s21c1
Sequence:CCGGCACCGGAGTCATCTCTTGTACCTCGAGGTACAAGAGATGACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-265s21c1
Sequence:CCGGCGTGGATGTGTACAGTGATTGCTCGAGCAATCACTGTACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-234s21c1
Sequence:CCGGTCCAGACGCCCATAACGTATCCTCGAGGATACGTTATGGGCGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032377.3-144s21c1
Sequence:CCGGCCTTCTGCAACCACGAGAAATCTCGAGATTTCTCGTGGTTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks