EMAIL THIS PAGE TO A FRIEND

ELOVL1

ELOVL fatty acid elongase 1

Synonyms: Ssc1
Gene ID:
Mouse(54325) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1
Rat(679532) ELOVL fatty acid elongase 1
sheep(101110801) ELOVL fatty acid elongase 1
naked mole-rat(101705922) ELOVL fatty acid elongase 1
domestic guinea pig(100718818) ELOVL fatty acid elongase 1
chicken(424564) ELOVL fatty acid elongase 1
dog(482533) ELOVL fatty acid elongase 1
cow(540348) ELOVL fatty acid elongase 1
domestic cat(101097500) ELOVL fatty acid elongase 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016031 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022821 Rosetta Predictions human pricing
NM_001044275 Rosetta Predictions rat pricing
NM_001039175 Rosetta Predictions mouse pricing
NM_001039176 Rosetta Predictions mouse pricing
NM_019422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152633 predicted 299
2 SASI_Hs01_00152634 predicted 816
3 SASI_Hs01_00152635 predicted 733
4 SASI_Hs01_00152636 predicted 862
5 SASI_Hs01_00152637 predicted 969
6 SASI_Hs01_00152638 predicted 1065
7 SASI_Hs01_00152639 predicted 834
8 SASI_Hs01_00152640 predicted 796
9 SASI_Hs01_00152641 predicted 496
10 SASI_Hs01_00152642 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205424 predicted 1049
2 SASI_Rn02_00205425 predicted 1078
3 SASI_Rn02_00205426 predicted 992
4 SASI_Rn02_00205427 predicted 997
5 SASI_Rn02_00205428 predicted 759
6 SASI_Rn02_00205429 predicted 388
7 SASI_Rn02_00205430 predicted 313
8 SASI_Rn02_00205431 predicted 891
9 SASI_Rn02_00205432 predicted 857
10 SASI_Rn02_00205433 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181844 predicted 1119
2 SASI_Mm01_00181845 predicted 658
3 SASI_Mm01_00181846 predicted 652
4 SASI_Mm01_00181847 predicted 686
5 SASI_Mm01_00181848 predicted 1012
6 SASI_Mm01_00181849 predicted 1269
7 SASI_Mm01_00181850 predicted 382
8 SASI_Mm01_00181851 predicted 779
9 SASI_Mm01_00181852 predicted 799
10 SASI_Mm02_00289924 predicted 971
11 SASI_Mm01_00181853 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077031 predicted 1312
2 SASI_Mm01_00077032 predicted 855
3 SASI_Mm01_00077033 predicted 853
4 SASI_Mm01_00077034 predicted 881
5 SASI_Mm01_00077035 predicted 1207
6 SASI_Mm01_00077036 predicted 1461
7 SASI_Mm01_00077037 predicted 577
8 SASI_Mm01_00077038 predicted 976
9 SASI_Mm01_00077039 predicted 1002
10 SASI_Mm02_00289925 predicted 1175
11 SASI_Mm01_00077040 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084245 predicted 1311
2 SASI_Mm01_00084246 predicted 855
3 SASI_Mm01_00084247 predicted 841
4 SASI_Mm01_00084248 predicted 879
5 SASI_Mm01_00084249 predicted 1200
6 SASI_Mm01_00084250 predicted 1460
7 SASI_Mm01_00084251 predicted 566
8 SASI_Mm01_00084252 predicted 969
9 SASI_Mm01_00084253 predicted 993
10 SASI_Mm02_00324346 predicted 1164
11 SASI_Mm01_00084254 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022821
VALIDATED
ELOVL1 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-635s21c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-772s21c1
Sequence:CCGGACATCTCCCAGTACTACTTTACTCGAGTAAAGTAGTACTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022821.2-619s21c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-1051s21c1
Sequence:CCGGCACCTGTGACCAAGGCTTATGCTCGAGCATAAGCCTTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-808s21c1
Sequence:CCGGACCAGTACCCAGTCATTATTCCTCGAGGAATAATGACTGGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022821
VALIDATED
ELOVL1 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-635s21c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-772s21c1
Sequence:CCGGACATCTCCCAGTACTACTTTACTCGAGTAAAGTAGTACTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022821.2-619s21c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-1051s21c1
Sequence:CCGGCACCTGTGACCAAGGCTTATGCTCGAGCATAAGCCTTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-808s21c1
Sequence:CCGGACCAGTACCCAGTCATTATTCCTCGAGGAATAATGACTGGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022821
VALIDATED
ELOVL1 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-635s21c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-772s21c1
Sequence:CCGGACATCTCCCAGTACTACTTTACTCGAGTAAAGTAGTACTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022821.2-619s21c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-1051s21c1
Sequence:CCGGCACCTGTGACCAAGGCTTATGCTCGAGCATAAGCCTTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022821.2-808s21c1
Sequence:CCGGACCAGTACCCAGTCATTATTCCTCGAGGAATAATGACTGGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019422
VALIDATED
ELOVL1 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.2-317s1c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-317s21c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-664s21c1
Sequence:CCGGTCGTCATGTACCTCTACTATGCTCGAGCATAGTAGAGGTACATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-629s21c1
Sequence:CCGGCTCCTTCCATGCCATGATAAACTCGAGTTTATCATGGCATGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-1437s21c1
Sequence:CCGGGCTCACTTGTGTCTTAATTAACTCGAGTTAATTAAGACACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-346s21c1
Sequence:CCGGTGATACTCTCCCTCTACATTGCTCGAGCAATGTAGAGGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-780s1c1
Sequence:CCGGGCCAATACTACTTCATGCCCACTCGAGTGGGCATGAAGTAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-656s1c1
Sequence:CCGGGTCGTCATGTACCTCTACTATCTCGAGATAGTAGAGGTACATGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019422.1-1026s1c1
Sequence:CCGGCATCCACAAGTGTCCTCTCTACTCGAGTAGAGAGGACACTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019422
VALIDATED
ELOVL1 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.2-317s1c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-317s21c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-664s21c1
Sequence:CCGGTCGTCATGTACCTCTACTATGCTCGAGCATAGTAGAGGTACATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-629s21c1
Sequence:CCGGCTCCTTCCATGCCATGATAAACTCGAGTTTATCATGGCATGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-1437s21c1
Sequence:CCGGGCTCACTTGTGTCTTAATTAACTCGAGTTAATTAAGACACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-346s21c1
Sequence:CCGGTGATACTCTCCCTCTACATTGCTCGAGCAATGTAGAGGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-780s1c1
Sequence:CCGGGCCAATACTACTTCATGCCCACTCGAGTGGGCATGAAGTAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-656s1c1
Sequence:CCGGGTCGTCATGTACCTCTACTATCTCGAGATAGTAGAGGTACATGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019422.1-1026s1c1
Sequence:CCGGCATCCACAAGTGTCCTCTCTACTCGAGTAGAGAGGACACTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019422
VALIDATED
ELOVL1 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.2-317s1c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-317s21c1
Sequence:CCGGCTTCATGATTGTCTACAATTTCTCGAGAAATTGTAGACAATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-664s21c1
Sequence:CCGGTCGTCATGTACCTCTACTATGCTCGAGCATAGTAGAGGTACATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019422.2-629s21c1
Sequence:CCGGCTCCTTCCATGCCATGATAAACTCGAGTTTATCATGGCATGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-1437s21c1
Sequence:CCGGGCTCACTTGTGTCTTAATTAACTCGAGTTAATTAAGACACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019422.2-346s21c1
Sequence:CCGGTGATACTCTCCCTCTACATTGCTCGAGCAATGTAGAGGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-780s1c1
Sequence:CCGGGCCAATACTACTTCATGCCCACTCGAGTGGGCATGAAGTAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019422.1-656s1c1
Sequence:CCGGGTCGTCATGTACCTCTACTATCTCGAGATAGTAGAGGTACATGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019422.1-1026s1c1
Sequence:CCGGCATCCACAAGTGTCCTCTCTACTCGAGTAGAGAGGACACTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016031
VALIDATED
ELOVL1 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-691s1c1
Sequence:CCGGCAACCCTACCTTTGGTGGAAACTCGAGTTTCCACCAAAGGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-292s1c1
Sequence:CCGGCCGTGGCTTCATGATTGTCTACTCGAGTAGACAATCATGAAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-609s1c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-640s1c1
Sequence:CCGGGCATGTCATAATGTACCTGTACTCGAGTACAGGTACATTATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-658s1c1
Sequence:CCGGGTACTACGGATTATCTGCCTTCTCGAGAAGGCAGATAATCCGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-625s1c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016031
VALIDATED
ELOVL1 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-691s1c1
Sequence:CCGGCAACCCTACCTTTGGTGGAAACTCGAGTTTCCACCAAAGGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-292s1c1
Sequence:CCGGCCGTGGCTTCATGATTGTCTACTCGAGTAGACAATCATGAAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-609s1c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-640s1c1
Sequence:CCGGGCATGTCATAATGTACCTGTACTCGAGTACAGGTACATTATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-658s1c1
Sequence:CCGGGTACTACGGATTATCTGCCTTCTCGAGAAGGCAGATAATCCGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-625s1c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016031
VALIDATED
ELOVL1 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-691s1c1
Sequence:CCGGCAACCCTACCTTTGGTGGAAACTCGAGTTTCCACCAAAGGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016031.1-292s1c1
Sequence:CCGGCCGTGGCTTCATGATTGTCTACTCGAGTAGACAATCATGAAGCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-609s1c1
Sequence:CCGGGCTCTTTCCATGCCATGATAACTCGAGTTATCATGGCATGGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-640s1c1
Sequence:CCGGGCATGTCATAATGTACCTGTACTCGAGTACAGGTACATTATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016031.1-658s1c1
Sequence:CCGGGTACTACGGATTATCTGCCTTCTCGAGAAGGCAGATAATCCGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016031.1-625s1c1
Sequence:CCGGGATAAACTCTTCCGTGCATGTCTCGAGACATGCACGGAAGAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks