EMAIL THIS PAGE TO A FRIEND

ELOVL2

ELOVL fatty acid elongase 2

86 Gene Product Result for
Synonyms: SSC2
UniProtKB ID: Q9NXB9, Q6P9E1, Q86W94
Gene ID:
Mouse(54326) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
Rat(498728) ELOVL fatty acid elongase 2
Zebrafish(678614) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
cow(615756) ELOVL fatty acid elongase 2
domestic cat(101093184) ELOVL fatty acid elongase 2
dog(488219) ELOVL fatty acid elongase 2
chicken(420858) ELOVL fatty acid elongase 2
domestic guinea pig(100724371) ELOVL fatty acid elongase 2
naked mole-rat(101699326) ELOVL fatty acid elongase 2
sheep(101116613) ELOVL fatty acid elongase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017770 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033101 MISSION® esiRNA esiRNA human ELOVL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017770 Rosetta Predictions human pricing
NM_001109118 Rosetta Predictions rat pricing
NM_019423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350605 predicted 862
2 SASI_Hs01_00018935 predicted 433
3 SASI_Hs01_00018937 predicted 1069
4 SASI_Hs01_00018938 predicted 661
5 SASI_Hs01_00018939 predicted 601
6 SASI_Hs01_00018940 predicted 882
7 SASI_Hs02_00350606 predicted 1001
8 SASI_Hs01_00018941 predicted 436
9 SASI_Hs02_00350607 predicted 533
10 SASI_Hs01_00018942 predicted 296
11 SASI_Hs01_00018936 predicted 404
12 SASI_Hs01_00018943 predicted 645
13 SASI_Hs01_00018944 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245300 predicted 341
2 SASI_Rn02_00245301 predicted 979
3 SASI_Rn02_00245302 predicted 329
4 SASI_Rn02_00245303 predicted 603
5 SASI_Rn02_00245304 predicted 536
6 SASI_Rn02_00245305 predicted 406
7 SASI_Rn02_00245306 predicted 1063
8 SASI_Rn02_00245307 predicted 466
9 SASI_Rn02_00245308 predicted 984
10 SASI_Rn02_00245309 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037333 predicted 318
2 SASI_Mm01_00037334 predicted 265
3 SASI_Mm01_00037335 predicted 877
4 SASI_Mm01_00037336 predicted 247
5 SASI_Mm01_00037337 predicted 569
6 SASI_Mm01_00037338 predicted 887
7 SASI_Mm01_00037339 predicted 590
8 SASI_Mm01_00037340 predicted 386
9 SASI_Mm02_00324347 predicted 458
10 SASI_Mm01_00037342 predicted 275
11 SASI_Mm01_00037341 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019423
ELOVL2 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019423.1-1210s1c1
Sequence:CCGGCGTTTCTTCATGGCAAGTCTTCTCGAGAAGACTTGCCATGAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-73s1c1
Sequence:CCGGGCTTTCTTGGACAACATGTTTCTCGAGAAACATGTTGTCCAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-261s1c1
Sequence:CCGGCACACTTCTTTCTGCGTATATCTCGAGATATACGCAGAAAGAAGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-868s1c1
Sequence:CCGGGCCCACTTAATTGTGGCTAATCTCGAGATTAGCCACAATTAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-186s1c1
Sequence:CCGGGCTGGGTAACAAGTACATGAACTCGAGTTCATGTACTTGTTACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019423.2-420s21c1
Sequence:CCGGTGGAGTTCCTGGACACGATTTCTCGAGAAATCGTGTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019423
ELOVL2 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019423.1-1210s1c1
Sequence:CCGGCGTTTCTTCATGGCAAGTCTTCTCGAGAAGACTTGCCATGAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-73s1c1
Sequence:CCGGGCTTTCTTGGACAACATGTTTCTCGAGAAACATGTTGTCCAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-261s1c1
Sequence:CCGGCACACTTCTTTCTGCGTATATCTCGAGATATACGCAGAAAGAAGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-868s1c1
Sequence:CCGGGCCCACTTAATTGTGGCTAATCTCGAGATTAGCCACAATTAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-186s1c1
Sequence:CCGGGCTGGGTAACAAGTACATGAACTCGAGTTCATGTACTTGTTACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019423.2-420s21c1
Sequence:CCGGTGGAGTTCCTGGACACGATTTCTCGAGAAATCGTGTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019423
ELOVL2 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019423.1-1210s1c1
Sequence:CCGGCGTTTCTTCATGGCAAGTCTTCTCGAGAAGACTTGCCATGAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-73s1c1
Sequence:CCGGGCTTTCTTGGACAACATGTTTCTCGAGAAACATGTTGTCCAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-261s1c1
Sequence:CCGGCACACTTCTTTCTGCGTATATCTCGAGATATACGCAGAAAGAAGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-868s1c1
Sequence:CCGGGCCCACTTAATTGTGGCTAATCTCGAGATTAGCCACAATTAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019423.1-186s1c1
Sequence:CCGGGCTGGGTAACAAGTACATGAACTCGAGTTCATGTACTTGTTACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019423.2-420s21c1
Sequence:CCGGTGGAGTTCCTGGACACGATTTCTCGAGAAATCGTGTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017770
VALIDATED
ELOVL2 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-843s1c1
Sequence:CCGGCGTTAGTCATCCTCTTCTTAACTCGAGTTAAGAAGAGGATGACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-649s1c1
Sequence:CCGGCCACATTCTTATGTACTCCTACTCGAGTAGGAGTACATAAGAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-250s1c1
Sequence:CCGGGCTCTCAATATGGCTGGGTAACTCGAGTTACCCAGCCATATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017770.2-1445s1c1
Sequence:CCGGCGGTGCATAATCATTCCATTTCTCGAGAAATGGAATGATTATGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-308s21c1
Sequence:CCGGATGGCTGGGTAACAAGTATATCTCGAGATATACTTGTTACCCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-503s21c1
Sequence:CCGGGGTGCTTTGGTGGTACTATTTCTCGAGAAATAGTACCACCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-212s21c1
Sequence:CCGGTATGTTTGGACCGCGAGATTCCTCGAGGAATCTCGCGGTCCAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-1460s21c1
Sequence:CCGGAGGGTATGTTCTAATCTATATCTCGAGATATAGATTAGAACATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017770.3-740s21c1
Sequence:CCGGATCTATGCACAAGTATCTTTGCTCGAGCAAAGATACTTGTGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017770
VALIDATED
ELOVL2 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-843s1c1
Sequence:CCGGCGTTAGTCATCCTCTTCTTAACTCGAGTTAAGAAGAGGATGACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-649s1c1
Sequence:CCGGCCACATTCTTATGTACTCCTACTCGAGTAGGAGTACATAAGAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-250s1c1
Sequence:CCGGGCTCTCAATATGGCTGGGTAACTCGAGTTACCCAGCCATATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017770.2-1445s1c1
Sequence:CCGGCGGTGCATAATCATTCCATTTCTCGAGAAATGGAATGATTATGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-308s21c1
Sequence:CCGGATGGCTGGGTAACAAGTATATCTCGAGATATACTTGTTACCCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-503s21c1
Sequence:CCGGGGTGCTTTGGTGGTACTATTTCTCGAGAAATAGTACCACCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-212s21c1
Sequence:CCGGTATGTTTGGACCGCGAGATTCCTCGAGGAATCTCGCGGTCCAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-1460s21c1
Sequence:CCGGAGGGTATGTTCTAATCTATATCTCGAGATATAGATTAGAACATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017770.3-740s21c1
Sequence:CCGGATCTATGCACAAGTATCTTTGCTCGAGCAAAGATACTTGTGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017770
VALIDATED
ELOVL2 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-843s1c1
Sequence:CCGGCGTTAGTCATCCTCTTCTTAACTCGAGTTAAGAAGAGGATGACTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-649s1c1
Sequence:CCGGCCACATTCTTATGTACTCCTACTCGAGTAGGAGTACATAAGAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017770.2-250s1c1
Sequence:CCGGGCTCTCAATATGGCTGGGTAACTCGAGTTACCCAGCCATATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017770.2-1445s1c1
Sequence:CCGGCGGTGCATAATCATTCCATTTCTCGAGAAATGGAATGATTATGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-308s21c1
Sequence:CCGGATGGCTGGGTAACAAGTATATCTCGAGATATACTTGTTACCCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-503s21c1
Sequence:CCGGGGTGCTTTGGTGGTACTATTTCTCGAGAAATAGTACCACCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-212s21c1
Sequence:CCGGTATGTTTGGACCGCGAGATTCCTCGAGGAATCTCGCGGTCCAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017770.3-1460s21c1
Sequence:CCGGAGGGTATGTTCTAATCTATATCTCGAGATATAGATTAGAACATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017770.3-740s21c1
Sequence:CCGGATCTATGCACAAGTATCTTTGCTCGAGCAAAGATACTTGTGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks