EMAIL THIS PAGE TO A FRIEND

ELOVL3

ELOVL fatty acid elongase 3

Synonyms: CIG-30 CIG30
UniProtKB ID: Q9HB03, Q5VZL3, Q8N180
Gene ID:
Human(83401) Summary: ELOVL3 plays a role in fatty acid chain elongation and formation of neutral lipids required for skin barrier function (Westerberg et al., 2004 [PubMed 14581464]
Mouse(12686) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3
Rat(309449) ELOVL fatty acid elongase 3
chicken(770955) ELOVL fatty acid elongase 3
cow(539782) ELOVL fatty acid elongase 3
domestic cat(101101255) ELOVL fatty acid elongase 3
dog(486855) ELOVL fatty acid elongase 3
sheep(101106896) ELOVL fatty acid elongase 3
naked mole-rat(101710549) ELOVL fatty acid elongase 3
domestic guinea pig(100718611) ELOVL fatty acid elongase 3
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152310 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152310 Rosetta Predictions human pricing
NM_001107602 Rosetta Predictions rat pricing
NM_007703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086480 predicted 251
2 SASI_Hs01_00086481 predicted 555
3 SASI_Hs01_00086482 predicted 1041
4 SASI_Hs01_00086483 predicted 624
5 SASI_Hs02_00365895 predicted 859
6 SASI_Hs01_00086485 predicted 990
7 SASI_Hs01_00086486 predicted 210
8 SASI_Hs01_00086487 predicted 773
9 SASI_Hs01_00086488 predicted 673
10 SASI_Hs01_00086489 predicted 465
11 SASI_Hs01_00086484 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230455 predicted 975
2 SASI_Rn02_00230456 predicted 1056
3 SASI_Rn02_00230457 predicted 460
4 SASI_Rn02_00230458 predicted 1081
5 SASI_Rn02_00230459 predicted 482
6 SASI_Rn02_00230460 predicted 473
7 SASI_Rn02_00230461 predicted 684
8 SASI_Rn02_00230462 predicted 729
9 SASI_Rn02_00230463 predicted 885
10 SASI_Rn02_00230464 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312264 predicted 637
2 SASI_Mm01_00099018 predicted 743
3 SASI_Mm02_00312265 predicted 1021
4 SASI_Mm01_00099020 predicted 963
5 SASI_Mm01_00099021 predicted 722
6 SASI_Mm01_00099022 predicted 220
7 SASI_Mm01_00099023 predicted 1080
8 SASI_Mm01_00099024 predicted 870
9 SASI_Mm01_00099025 predicted 534
10 SASI_Mm01_00099026 predicted 298
11 SASI_Mm01_00099019 predicted 503
12 SASI_Mm01_00099027 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152310
ELOVL3 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152310.1-472s21c1
Sequence:CCGGCTTCATCAACTTCATCGATAACTCGAGTTATCGATGAAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-779s1c1
Sequence:CCGGCAGATCTTGCAGATGTTTGTACTCGAGTACAAACATCTGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152310.1-1049s1c1
Sequence:CCGGGAGAATGATTAGGTTGCCTTACTCGAGTAAGGCAACCTAATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-319s1c1
Sequence:CCGGGAACTACATGAAGGAACGCAACTCGAGTTGCGTTCCTTCATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152310.1-1061s1c1
Sequence:CCGGGTTGCCTTACCTGCATGGTTTCTCGAGAAACCATGCAGGTAAGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-706s1c1
Sequence:CCGGGTACACCTACTACACTCTGAACTCGAGTTCAGAGTGTAGTAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152310
ELOVL3 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152310.1-472s21c1
Sequence:CCGGCTTCATCAACTTCATCGATAACTCGAGTTATCGATGAAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-779s1c1
Sequence:CCGGCAGATCTTGCAGATGTTTGTACTCGAGTACAAACATCTGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152310.1-1049s1c1
Sequence:CCGGGAGAATGATTAGGTTGCCTTACTCGAGTAAGGCAACCTAATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-319s1c1
Sequence:CCGGGAACTACATGAAGGAACGCAACTCGAGTTGCGTTCCTTCATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152310.1-1061s1c1
Sequence:CCGGGTTGCCTTACCTGCATGGTTTCTCGAGAAACCATGCAGGTAAGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-706s1c1
Sequence:CCGGGTACACCTACTACACTCTGAACTCGAGTTCAGAGTGTAGTAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152310
ELOVL3 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152310.1-472s21c1
Sequence:CCGGCTTCATCAACTTCATCGATAACTCGAGTTATCGATGAAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-779s1c1
Sequence:CCGGCAGATCTTGCAGATGTTTGTACTCGAGTACAAACATCTGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152310.1-1049s1c1
Sequence:CCGGGAGAATGATTAGGTTGCCTTACTCGAGTAAGGCAACCTAATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-319s1c1
Sequence:CCGGGAACTACATGAAGGAACGCAACTCGAGTTGCGTTCCTTCATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152310.1-1061s1c1
Sequence:CCGGGTTGCCTTACCTGCATGGTTTCTCGAGAAACCATGCAGGTAAGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152310.1-706s1c1
Sequence:CCGGGTACACCTACTACACTCTGAACTCGAGTTCAGAGTGTAGTAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007703
ELOVL3 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007703.1-717s1c1
Sequence:CCGGGTACACTTACTACACTATGAACTCGAGTTCATAGTGTAGTAAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-507s1c1
Sequence:CCGGCGTAGTCAGATTCTGGTCCTTCTCGAGAAGGACCAGAATCTGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-508s1c1
Sequence:CCGGGTAGTCAGATTCTGGTCCTTTCTCGAGAAAGGACCAGAATCTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1428s1c1
Sequence:CCGGGCACACACAAACACTCAATAACTCGAGTTATTGAGTGTTTGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1295s1c1
Sequence:CCGGGTCAACATGATCTTGAGGATTCTCGAGAATCCTCAAGATCATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007703
ELOVL3 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007703.1-717s1c1
Sequence:CCGGGTACACTTACTACACTATGAACTCGAGTTCATAGTGTAGTAAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-507s1c1
Sequence:CCGGCGTAGTCAGATTCTGGTCCTTCTCGAGAAGGACCAGAATCTGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-508s1c1
Sequence:CCGGGTAGTCAGATTCTGGTCCTTTCTCGAGAAAGGACCAGAATCTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1428s1c1
Sequence:CCGGGCACACACAAACACTCAATAACTCGAGTTATTGAGTGTTTGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1295s1c1
Sequence:CCGGGTCAACATGATCTTGAGGATTCTCGAGAATCCTCAAGATCATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007703
ELOVL3 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007703.1-717s1c1
Sequence:CCGGGTACACTTACTACACTATGAACTCGAGTTCATAGTGTAGTAAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-507s1c1
Sequence:CCGGCGTAGTCAGATTCTGGTCCTTCTCGAGAAGGACCAGAATCTGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007703.1-508s1c1
Sequence:CCGGGTAGTCAGATTCTGGTCCTTTCTCGAGAAAGGACCAGAATCTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1428s1c1
Sequence:CCGGGCACACACAAACACTCAATAACTCGAGTTATTGAGTGTTTGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007703.1-1295s1c1
Sequence:CCGGGTCAACATGATCTTGAGGATTCTCGAGAATCCTCAAGATCATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks