EMAIL THIS PAGE TO A FRIEND

ELOVL4

ELOVL fatty acid elongase 4

157 Gene Product Result for
Synonyms: ADMD CT118 ISQMR STGD2 STGD3
UniProtKB ID: Q9GZR5, B2R6B5, Q5TCS2, Q86YJ1, Q9H139
Gene ID:
Human(6785) Summary: This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
Mouse(83603) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Rat(315851) ELOVL fatty acid elongase 4
domestic guinea pig(100720101) ELOVL fatty acid elongase 4
naked mole-rat(101701805) ELOVL fatty acid elongase 4
sheep(101113417) ELOVL fatty acid elongase 4
chicken(421850) ELOVL fatty acid elongase 4
cow(532015) ELOVL fatty acid elongase 4
domestic cat(101101313) ELOVL fatty acid elongase 4
dog(481894) ELOVL fatty acid elongase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022726 Rosetta Predictions human pricing
XM_001062735 Rosetta Predictions rat pricing
XM_236476 Rosetta Predictions rat pricing
NM_148941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203341 predicted 904
2 SASI_Hs01_00203342 predicted 598
3 SASI_Hs01_00203343 predicted 657
4 SASI_Hs01_00203344 predicted 658
5 SASI_Hs01_00203345 predicted 895
6 SASI_Hs01_00203346 predicted 458
7 SASI_Hs02_00355951 predicted 872
8 SASI_Hs01_00203348 predicted 968
9 SASI_Hs01_00203349 predicted 608
10 SASI_Hs01_00203350 predicted 929
11 SASI_Hs01_00203347 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304433 predicted 1041
2 SASI_Rn02_00304434 predicted 328
3 SASI_Rn02_00304435 predicted 1111
4 SASI_Rn02_00304436 predicted 460
5 SASI_Rn02_00304437 predicted 584
6 SASI_Rn02_00304438 predicted 977
7 SASI_Rn02_00304439 predicted 431
8 SASI_Rn02_00304440 predicted 326
9 SASI_Rn02_00304441 predicted 518
10 SASI_Rn02_00304442 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390069 predicted 1043
2 SASI_Rn02_00390070 predicted 327
3 SASI_Rn02_00390071 predicted 1112
4 SASI_Rn02_00390072 predicted 457
5 SASI_Rn02_00390073 predicted 580
6 SASI_Rn02_00390074 predicted 985
7 SASI_Rn02_00390075 predicted 433
8 SASI_Rn02_00390076 predicted 332
9 SASI_Rn02_00390077 predicted 525
10 SASI_Rn02_00390078 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095221 predicted 553
2 SASI_Mm01_00095222 predicted 286
3 SASI_Mm01_00095224 predicted 363
4 SASI_Mm01_00095225 predicted 286
5 SASI_Mm01_00095226 predicted 902
6 SASI_Mm01_00095227 predicted 914
7 SASI_Mm01_00095228 predicted 274
8 SASI_Mm01_00095229 predicted 348
9 SASI_Mm02_00342753 predicted 925
10 SASI_Mm01_00095230 predicted 363
11 SASI_Mm01_00095223 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148941
VALIDATED
ELOVL4 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-415s1c1
Sequence:CCGGGATGTTAATGAAGTCAGGATACTCGAGTATCCTGACTTCATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-822s1c1
Sequence:CCGGCTACGCCATCAGCTTCATCTTCTCGAGAAGATGAAGCTGATGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-1495s21c1
Sequence:CCGGTCCACCTCTAGTCCGAATATTCTCGAGAATATTCGGACTAGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-921s21c1
Sequence:CCGGCTCATCGAACGGCGTGAATAACTCGAGTTATTCACGCCGTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-290s21c1
Sequence:CCGGGCTTAGTACTCATAATCTATACTCGAGTATAGATTATGAGTACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-371s21c1
Sequence:CCGGACGCAGGATACAGCTATATTTCTCGAGAAATATAGCTGTATCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-461s21c1
Sequence:CCGGTATCGAAAGGCGTTGAGTATTCTCGAGAATACTCAACGCCTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148941
VALIDATED
ELOVL4 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-415s1c1
Sequence:CCGGGATGTTAATGAAGTCAGGATACTCGAGTATCCTGACTTCATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-822s1c1
Sequence:CCGGCTACGCCATCAGCTTCATCTTCTCGAGAAGATGAAGCTGATGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-1495s21c1
Sequence:CCGGTCCACCTCTAGTCCGAATATTCTCGAGAATATTCGGACTAGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-921s21c1
Sequence:CCGGCTCATCGAACGGCGTGAATAACTCGAGTTATTCACGCCGTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-290s21c1
Sequence:CCGGGCTTAGTACTCATAATCTATACTCGAGTATAGATTATGAGTACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-371s21c1
Sequence:CCGGACGCAGGATACAGCTATATTTCTCGAGAAATATAGCTGTATCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-461s21c1
Sequence:CCGGTATCGAAAGGCGTTGAGTATTCTCGAGAATACTCAACGCCTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148941
VALIDATED
ELOVL4 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-415s1c1
Sequence:CCGGGATGTTAATGAAGTCAGGATACTCGAGTATCCTGACTTCATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148941.1-822s1c1
Sequence:CCGGCTACGCCATCAGCTTCATCTTCTCGAGAAGATGAAGCTGATGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-1495s21c1
Sequence:CCGGTCCACCTCTAGTCCGAATATTCTCGAGAATATTCGGACTAGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-921s21c1
Sequence:CCGGCTCATCGAACGGCGTGAATAACTCGAGTTATTCACGCCGTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-290s21c1
Sequence:CCGGGCTTAGTACTCATAATCTATACTCGAGTATAGATTATGAGTACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-371s21c1
Sequence:CCGGACGCAGGATACAGCTATATTTCTCGAGAAATATAGCTGTATCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_148941.1-461s21c1
Sequence:CCGGTATCGAAAGGCGTTGAGTATTCTCGAGAATACTCAACGCCTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022726
VALIDATED
ELOVL4 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-2578s1c1
Sequence:CCGGGCAAAGGGATTACTAGAGAAACTCGAGTTTCTCTAGTAATCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-877s1c1
Sequence:CCGGCCTGACTATGTTGCAACTGATCTCGAGATCAGTTGCAACATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-452s1c1
Sequence:CCGGCGTCTAGTGCTCATTATCTATCTCGAGATAGATAATGAGCACTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-525s1c1
Sequence:CCGGGATCATATAATGCGGGATATACTCGAGTATATCCCGCATTATATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-983s1c1
Sequence:CCGGGCCTATGCAATCAGCTTCATACTCGAGTATGAAGCTGATTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022726.3-798s21c1
Sequence:CCGGATCATCACTGTACGATGTTTACTCGAGTAAACATCGTACAGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1401s21c1
Sequence:CCGGAGACTGAGTAAAGTGTTAATACTCGAGTATTAACACTTTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1492s21c1
Sequence:CCGGTCCAGACCAAAGCAATCATTACTCGAGTAATGATTGCTTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1613s21c1
Sequence:CCGGCGATCACAGAAACGGTCTTTACTCGAGTAAAGACCGTTTCTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022726
VALIDATED
ELOVL4 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-2578s1c1
Sequence:CCGGGCAAAGGGATTACTAGAGAAACTCGAGTTTCTCTAGTAATCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-877s1c1
Sequence:CCGGCCTGACTATGTTGCAACTGATCTCGAGATCAGTTGCAACATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-452s1c1
Sequence:CCGGCGTCTAGTGCTCATTATCTATCTCGAGATAGATAATGAGCACTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-525s1c1
Sequence:CCGGGATCATATAATGCGGGATATACTCGAGTATATCCCGCATTATATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-983s1c1
Sequence:CCGGGCCTATGCAATCAGCTTCATACTCGAGTATGAAGCTGATTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022726.3-798s21c1
Sequence:CCGGATCATCACTGTACGATGTTTACTCGAGTAAACATCGTACAGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1401s21c1
Sequence:CCGGAGACTGAGTAAAGTGTTAATACTCGAGTATTAACACTTTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1492s21c1
Sequence:CCGGTCCAGACCAAAGCAATCATTACTCGAGTAATGATTGCTTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1613s21c1
Sequence:CCGGCGATCACAGAAACGGTCTTTACTCGAGTAAAGACCGTTTCTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022726
VALIDATED
ELOVL4 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-2578s1c1
Sequence:CCGGGCAAAGGGATTACTAGAGAAACTCGAGTTTCTCTAGTAATCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-877s1c1
Sequence:CCGGCCTGACTATGTTGCAACTGATCTCGAGATCAGTTGCAACATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-452s1c1
Sequence:CCGGCGTCTAGTGCTCATTATCTATCTCGAGATAGATAATGAGCACTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022726.2-525s1c1
Sequence:CCGGGATCATATAATGCGGGATATACTCGAGTATATCCCGCATTATATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022726.2-983s1c1
Sequence:CCGGGCCTATGCAATCAGCTTCATACTCGAGTATGAAGCTGATTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022726.3-798s21c1
Sequence:CCGGATCATCACTGTACGATGTTTACTCGAGTAAACATCGTACAGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1401s21c1
Sequence:CCGGAGACTGAGTAAAGTGTTAATACTCGAGTATTAACACTTTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1492s21c1
Sequence:CCGGTCCAGACCAAAGCAATCATTACTCGAGTAATGATTGCTTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022726.3-1613s21c1
Sequence:CCGGCGATCACAGAAACGGTCTTTACTCGAGTAAAGACCGTTTCTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks