EMAIL THIS PAGE TO A FRIEND

ELOVL5

ELOVL fatty acid elongase 5

154 Gene Product Result for
Synonyms: HELO1 dJ483K16.1
Gene ID:
Human(60481) Summary: ELOVL5 plays a role in elongation of long-chain polyunsaturated fatty acids (Leonard et al., 2000 [PubMed 10970790]
Mouse(68801) ELOVL family member 5, elongation of long chain fatty acids (yeast)
Rat(171400) ELOVL fatty acid elongase 5
Zebrafish(393425) ELOVL family member 5, elongation of long chain fatty acids (yeast)
cow(617293) ELOVL fatty acid elongase 5
domestic cat(101086147) ELOVL fatty acid elongase 5
chicken(428646) ELOVL fatty acid elongase 5
dog(610377) ELOVL fatty acid elongase 5
Goat(100861282) ELOVL fatty acid elongase 5
sheep(101108431) ELOVL fatty acid elongase 5
naked mole-rat(101717423) ELOVL fatty acid elongase 5
domestic guinea pig(100727016) ELOVL fatty acid elongase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021814 Rosetta Predictions human pricing
NM_134382 Rosetta Predictions rat pricing
NM_134255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165131 predicted 1265
2 SASI_Hs02_00355127 predicted 1259
3 SASI_Hs01_00165132 predicted 1329
4 SASI_Hs01_00165133 predicted 563
5 SASI_Hs01_00165134 predicted 1328
6 SASI_Hs01_00165135 predicted 676
7 SASI_Hs01_00165136 predicted 576
8 SASI_Hs01_00165138 predicted 907
9 SASI_Hs01_00165139 predicted 870
10 SASI_Hs01_00165140 predicted 1320
11 SASI_Hs01_00165137 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032641 predicted 220
2 SASI_Rn01_00032644 predicted 573
3 SASI_Rn01_00032645 predicted 425
4 SASI_Rn01_00032646 predicted 304
5 SASI_Rn01_00032648 predicted 619
6 SASI_Rn01_00032649 predicted 325
7 SASI_Rn02_00267945 predicted 245
8 SASI_Rn02_00267946 predicted 220
9 SASI_Rn01_00032650 predicted 428
10 SASI_Rn02_00267947 predicted 216
11 SASI_Rn01_00032642 predicted 527
12 SASI_Rn01_00032643 predicted 447
13 SASI_Rn01_00032647 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183350 predicted 393
2 SASI_Mm01_00183351 predicted 252
3 SASI_Mm01_00183352 predicted 890
4 SASI_Mm01_00183353 predicted 887
5 SASI_Mm01_00183354 predicted 1132
6 SASI_Mm01_00183356 predicted 529
7 SASI_Mm01_00183357 predicted 670
8 SASI_Mm01_00183358 predicted 800
9 SASI_Mm01_00183359 predicted 388
10 SASI_Mm02_00339560 predicted 224
11 SASI_Mm01_00183355 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021814
VALIDATED
ELOVL5 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 5
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-438s21c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-681s21c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1053s21c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1083s21c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-791s1c1
Sequence:CCGGGATGCTGAACATCTGGTGGTTCTCGAGAACCACCAGATGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1175s1c1
Sequence:CCGGGAATGGACACACCAACAGCTTCTCGAGAAGCTGTTGGTGTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021814.2-445s1c1
Sequence:CCGGCCACATTTATCTGCTCTGTCACTCGAGTGACAGAGCAGATAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021814.2-689s1c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-446s1c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1091s1c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-965s1c1
Sequence:CCGGGCTTCAGTTTGTGCTGACAATCTCGAGATTGTCAGCACAAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-797s1c1
Sequence:CCGGGAACATCTGGTGGTTTGTGATCTCGAGATCACAAACCACCAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1061s1c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-647s1c1
Sequence:CCGGCGCAGGAGAATCAGATATGAACTCGAGTTCATATCTGATTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021814
VALIDATED
ELOVL5 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 5
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-438s21c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-681s21c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1053s21c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1083s21c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-791s1c1
Sequence:CCGGGATGCTGAACATCTGGTGGTTCTCGAGAACCACCAGATGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1175s1c1
Sequence:CCGGGAATGGACACACCAACAGCTTCTCGAGAAGCTGTTGGTGTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021814.2-445s1c1
Sequence:CCGGCCACATTTATCTGCTCTGTCACTCGAGTGACAGAGCAGATAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021814.2-689s1c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-446s1c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1091s1c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-965s1c1
Sequence:CCGGGCTTCAGTTTGTGCTGACAATCTCGAGATTGTCAGCACAAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-797s1c1
Sequence:CCGGGAACATCTGGTGGTTTGTGATCTCGAGATCACAAACCACCAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1061s1c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-647s1c1
Sequence:CCGGCGCAGGAGAATCAGATATGAACTCGAGTTCATATCTGATTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021814
VALIDATED
ELOVL5 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 5
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-438s21c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-681s21c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1053s21c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021814.3-1083s21c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-791s1c1
Sequence:CCGGGATGCTGAACATCTGGTGGTTCTCGAGAACCACCAGATGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1175s1c1
Sequence:CCGGGAATGGACACACCAACAGCTTCTCGAGAAGCTGTTGGTGTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021814.2-445s1c1
Sequence:CCGGCCACATTTATCTGCTCTGTCACTCGAGTGACAGAGCAGATAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021814.2-689s1c1
Sequence:CCGGGTACTACTTCTCCAAACTCATCTCGAGATGAGTTTGGAGAAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-446s1c1
Sequence:CCGGCACATTTATCTGCTCTGTCATCTCGAGATGACAGAGCAGATAAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1091s1c1
Sequence:CCGGCTACATTCAGACCTACAACAACTCGAGTTGTTGTAGGTCTGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-965s1c1
Sequence:CCGGGCTTCAGTTTGTGCTGACAATCTCGAGATTGTCAGCACAAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-797s1c1
Sequence:CCGGGAACATCTGGTGGTTTGTGATCTCGAGATCACAAACCACCAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021814.2-1061s1c1
Sequence:CCGGGATTTCCCTGATTGCTCTCTTCTCGAGAAGAGAGCAATCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021814.2-647s1c1
Sequence:CCGGCGCAGGAGAATCAGATATGAACTCGAGTTCATATCTGATTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134255
VALIDATED
ELOVL5 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-389s21c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134255.2-283s21c1
Sequence:CCGGCTGTTATTTACTTACTCATTGCTCGAGCAATGAGTAAGTAAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-700s21c1
Sequence:CCGGTCCTCATGTACTCGTACTATGCTCGAGCATAGTACGAGTACATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-255s21c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-1505s21c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-1505s1c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-699s1c1
Sequence:CCGGGTCCTCATGTACTCGTACTATCTCGAGATAGTACGAGTACATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-255s1c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134255.2-470s1c1
Sequence:CCGGCGCGGGAGAATCCGATATGAACTCGAGTTCATATCGGATTCTCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-389s1c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134255
VALIDATED
ELOVL5 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-389s21c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134255.2-283s21c1
Sequence:CCGGCTGTTATTTACTTACTCATTGCTCGAGCAATGAGTAAGTAAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-700s21c1
Sequence:CCGGTCCTCATGTACTCGTACTATGCTCGAGCATAGTACGAGTACATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-255s21c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-1505s21c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-1505s1c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-699s1c1
Sequence:CCGGGTCCTCATGTACTCGTACTATCTCGAGATAGTACGAGTACATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-255s1c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134255.2-470s1c1
Sequence:CCGGCGCGGGAGAATCCGATATGAACTCGAGTTCATATCGGATTCTCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-389s1c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134255
VALIDATED
ELOVL5 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-389s21c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134255.2-283s21c1
Sequence:CCGGCTGTTATTTACTTACTCATTGCTCGAGCAATGAGTAAGTAAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-700s21c1
Sequence:CCGGTCCTCATGTACTCGTACTATGCTCGAGCATAGTACGAGTACATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-255s21c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134255.2-1505s21c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-1505s1c1
Sequence:CCGGGCCCAGAGCTTGTTAGTTTAACTCGAGTTAAACTAACAAGCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-699s1c1
Sequence:CCGGGTCCTCATGTACTCGTACTATCTCGAGATAGTACGAGTACATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-255s1c1
Sequence:CCGGGACAATTACATCCCTACGTTTCTCGAGAAACGTAGGGATGTAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134255.2-470s1c1
Sequence:CCGGCGCGGGAGAATCCGATATGAACTCGAGTTCATATCGGATTCTCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134255.2-389s1c1
Sequence:CCGGGCTGTCTCTCTACATGTTCTACTCGAGTAGAACATGTAGAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks