EMAIL THIS PAGE TO A FRIEND

ELOVL6

ELOVL fatty acid elongase 6

114 Gene Product Result for
Synonyms: FACE FAE LCE
UniProtKB ID: Q9H5J4, Q4W5L0, Q8NCD1
Gene ID:
Human(79071) Summary: Fatty acid elongases (EC 6.2.1.3), such as ELOVL6, use malonyl-CoA as a 2-carbon donor in the first and rate-limiting step of fatty acid elongation (Moon et al., 2001 [PubMed 11567032]
Mouse(170439) ELOVL family member 6, elongation of long chain fatty acids (yeast)
Rat(171402) ELOVL fatty acid elongase 6
domestic guinea pig(100718388) ELOVL fatty acid elongase 6
naked mole-rat(101721348) ELOVL fatty acid elongase 6
sheep(101118274) ELOVL fatty acid elongase 6
Zebrafish(317738) ELOVL family member 6, elongation of long chain fatty acids (yeast)
chicken(428772) ELOVL fatty acid elongase 6
dog(487900) ELOVL fatty acid elongase 6
cow(533333) ELOVL fatty acid elongase 6
domestic cat(101082563) ELOVL fatty acid elongase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024090 Rosetta Predictions human pricing
NM_134383 Rosetta Predictions rat pricing
NM_130450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242071 predicted 567
2 SASI_Hs01_00242072 predicted 615
3 SASI_Hs01_00242073 predicted 586
4 SASI_Hs01_00242075 predicted 289
5 SASI_Hs01_00242076 predicted 611
6 SASI_Hs01_00242077 predicted 518
7 SASI_Hs01_00242078 predicted 728
8 SASI_Hs01_00242079 predicted 329
9 SASI_Hs01_00242080 predicted 635
10 SASI_Hs02_00356566 predicted 505
11 SASI_Hs01_00242074 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089376 predicted 596
2 SASI_Rn01_00089377 predicted 842
3 SASI_Rn01_00089378 predicted 449
4 SASI_Rn02_00267948 predicted 738
5 SASI_Rn01_00089379 predicted 417
6 SASI_Rn01_00089380 predicted 768
7 SASI_Rn01_00089381 predicted 456
8 SASI_Rn01_00089382 predicted 492
9 SASI_Rn01_00089383 predicted 703
10 SASI_Rn01_00089384 predicted 198
11 SASI_Rn01_00089385 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091307 predicted 463
2 SASI_Mm01_00091308 predicted 384
3 SASI_Mm01_00091309 predicted 207
4 SASI_Mm01_00091302 predicted 1017
5 SASI_Mm01_00091310 predicted 422
6 SASI_Mm01_00091303 predicted 898
7 SASI_Mm01_00091311 predicted 445
8 SASI_Mm02_00338256 predicted 542
9 SASI_Mm02_00338257 predicted 381
10 SASI_Mm02_00338258 predicted 341
11 SASI_Mm01_00091304 predicted 630
12 SASI_Mm01_00091305 predicted 640
13 SASI_Mm01_00091306 predicted 832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024090
VALIDATED
ELOVL6 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-883s1c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-427s1c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-1238s1c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-328s1c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-392s1c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024090.1-486s1c1
Sequence:CCGGCCCTTGCAGTCTTCAGTATATCTCGAGATATACTGAAGACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-1287s21c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-932s21c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-476s21c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-441s21c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-377s21c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024090
VALIDATED
ELOVL6 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-883s1c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-427s1c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-1238s1c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-328s1c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-392s1c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024090.1-486s1c1
Sequence:CCGGCCCTTGCAGTCTTCAGTATATCTCGAGATATACTGAAGACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-1287s21c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-932s21c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-476s21c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-441s21c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-377s21c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024090
VALIDATED
ELOVL6 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-883s1c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-427s1c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-1238s1c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-328s1c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024090.1-392s1c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024090.1-486s1c1
Sequence:CCGGCCCTTGCAGTCTTCAGTATATCTCGAGATATACTGAAGACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-1287s21c1
Sequence:CCGGCCAGTAAGTTTATGATCCTTTCTCGAGAAAGGATCATAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-932s21c1
Sequence:CCGGCCAGATCACTCAGATGCTGATCTCGAGATCAGCATCTGAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-476s21c1
Sequence:CCGGCCTAATGAATAAACGAGCAAACTCGAGTTTGCTCGTTTATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024090.2-441s21c1
Sequence:CCGGGCTCTGTATGCTGCCTTTATACTCGAGTATAAAGGCAGCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024090.2-377s21c1
Sequence:CCGGGTTCAACGAGAATGAAGCCATCTCGAGATGGCTTCATTCTCGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130450
VALIDATED
ELOVL6 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-2918s1c1
Sequence:CCGGCCCATGTAGATCAAGTCATAACTCGAGTTATGACTTGATCTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-722s1c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130450.1-4165s1c1
Sequence:CCGGGCTGTCTTTATGAGACCGATTCTCGAGAATCGGTCTCATAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-154s1c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-470s1c1
Sequence:CCGGGATATTCATCATTCTGAGGAACTCGAGTTCCTCAGAATGATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-345s1c2
Sequence:CCGGCTGTACATTCTGATGACCAAACTCGAGTTTGGTCATCAGAATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-207s21c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.2-464s1c1
Sequence:CCGGGTCAGCAAATTCTGGGCTTATCTCGAGATAAGCCCAGAATTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-714s21c1
Sequence:CCGGCCCGGAAGTTTGCCATGTTCACTCGAGTGAACATGGCAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-795s21c1
Sequence:CCGGACTGGATGCAGCATGACAACGCTCGAGCGTTGTCATGCTGCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-775s21c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-671s21c1
Sequence:CCGGATGTACTCTTACTACGCCTTGCTCGAGCAAGGCGTAGTAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130450
VALIDATED
ELOVL6 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-2918s1c1
Sequence:CCGGCCCATGTAGATCAAGTCATAACTCGAGTTATGACTTGATCTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-722s1c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130450.1-4165s1c1
Sequence:CCGGGCTGTCTTTATGAGACCGATTCTCGAGAATCGGTCTCATAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-154s1c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-470s1c1
Sequence:CCGGGATATTCATCATTCTGAGGAACTCGAGTTCCTCAGAATGATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-345s1c2
Sequence:CCGGCTGTACATTCTGATGACCAAACTCGAGTTTGGTCATCAGAATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-207s21c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.2-464s1c1
Sequence:CCGGGTCAGCAAATTCTGGGCTTATCTCGAGATAAGCCCAGAATTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-714s21c1
Sequence:CCGGCCCGGAAGTTTGCCATGTTCACTCGAGTGAACATGGCAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-795s21c1
Sequence:CCGGACTGGATGCAGCATGACAACGCTCGAGCGTTGTCATGCTGCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-775s21c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-671s21c1
Sequence:CCGGATGTACTCTTACTACGCCTTGCTCGAGCAAGGCGTAGTAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130450
VALIDATED
ELOVL6 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-2918s1c1
Sequence:CCGGCCCATGTAGATCAAGTCATAACTCGAGTTATGACTTGATCTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-722s1c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130450.1-4165s1c1
Sequence:CCGGGCTGTCTTTATGAGACCGATTCTCGAGAATCGGTCTCATAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130450.1-154s1c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-470s1c1
Sequence:CCGGGATATTCATCATTCTGAGGAACTCGAGTTCCTCAGAATGATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.1-345s1c2
Sequence:CCGGCTGTACATTCTGATGACCAAACTCGAGTTTGGTCATCAGAATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-207s21c1
Sequence:CCGGCCATCCAATGGATGCAGGAAACTCGAGTTTCCTGCATCCATTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130450.2-464s1c1
Sequence:CCGGGTCAGCAAATTCTGGGCTTATCTCGAGATAAGCCCAGAATTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-714s21c1
Sequence:CCGGCCCGGAAGTTTGCCATGTTCACTCGAGTGAACATGGCAAACTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-795s21c1
Sequence:CCGGACTGGATGCAGCATGACAACGCTCGAGCGTTGTCATGCTGCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-775s21c1
Sequence:CCGGCATTAACTACCTGGTCTTCAACTCGAGTTGAAGACCAGGTAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130450.2-671s21c1
Sequence:CCGGATGTACTCTTACTACGCCTTGCTCGAGCAAGGCGTAGTAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks