EMAIL THIS PAGE TO A FRIEND

ELOVL7

ELOVL fatty acid elongase 7

107 Gene Product Result for
UniProtKB ID: A1L3X0, Q589T3, Q9H5D0, Q9NT66
Gene ID:
Mouse(74559) ELOVL family member 7, elongation of long chain fatty acids (yeast)
Rat(361895) ELOVL fatty acid elongase 7
chicken(431579) ELOVL fatty acid elongase 7
dog(608997) ELOVL fatty acid elongase 7
domestic cat(101098770) ELOVL fatty acid elongase 7
cow(614096) ELOVL fatty acid elongase 7
sheep(101108515) ELOVL fatty acid elongase 7
naked mole-rat(101725989) ELOVL fatty acid elongase 7
domestic guinea pig(100735649) ELOVL fatty acid elongase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49908 Anti-ELOVL7 antibody produced in rabbit IgG fraction of antiserum rat, rabbit, human, mouse, bovine, canine, guinea pig, horse
western blot pricing
SAB3500390 Anti-ELOVL7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA036337 Anti-ELOVL7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024930 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104558 Rosetta Predictions human pricing
NM_024930 Rosetta Predictions human pricing
XM_001065454 Rosetta Predictions rat pricing
XM_342192 Rosetta Predictions rat pricing
NM_029001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323734 predicted 794
2 SASI_Hs02_00323735 predicted 655
3 SASI_Hs02_00323736 predicted 348
4 SASI_Hs02_00323737 predicted 566
5 SASI_Hs02_00323738 predicted 509
6 SASI_Hs02_00323739 predicted 733
7 SASI_Hs02_00323740 predicted 838
8 SASI_Hs02_00323741 predicted 424
9 SASI_Hs02_00323742 predicted 738
10 SASI_Hs02_00323743 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094861 predicted 841
2 SASI_Hs01_00094862 predicted 710
3 SASI_Hs01_00094863 predicted 399
4 SASI_Hs01_00094864 predicted 619
5 SASI_Hs01_00094865 predicted 564
6 SASI_Hs01_00094866 predicted 790
7 SASI_Hs01_00094867 predicted 890
8 SASI_Hs01_00094869 predicted 476
9 SASI_Hs01_00094870 predicted 789
10 SASI_Hs02_00357556 predicted 904
11 SASI_Hs01_00094868 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314189 predicted 849
2 SASI_Rn02_00314190 predicted 665
3 SASI_Rn02_00314191 predicted 378
4 SASI_Rn02_00314192 predicted 591
5 SASI_Rn02_00314193 predicted 773
6 SASI_Rn02_00314194 predicted 335
7 SASI_Rn02_00314195 predicted 621
8 SASI_Rn02_00314196 predicted 299
9 SASI_Rn02_00314197 predicted 633
10 SASI_Rn02_00314198 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393886 predicted 1009
2 SASI_Rn02_00393887 predicted 832
3 SASI_Rn02_00393888 predicted 364
4 SASI_Rn02_00393889 predicted 542
5 SASI_Rn02_00393890 predicted 937
6 SASI_Rn02_00393891 predicted 779
7 SASI_Rn02_00393892 predicted 463
8 SASI_Rn02_00393893 predicted 796
9 SASI_Rn02_00393894 predicted 588
10 SASI_Rn02_00393895 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091741 predicted 339
2 SASI_Mm01_00091742 predicted 915
3 SASI_Mm01_00091743 predicted 772
4 SASI_Mm01_00091744 predicted 487
5 SASI_Mm01_00091745 predicted 754
6 SASI_Mm01_00091746 predicted 427
7 SASI_Mm01_00091747 predicted 1013
8 SASI_Mm01_00091748 predicted 243
9 SASI_Mm01_00091749 predicted 421
10 SASI_Mm01_00091750 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029001
VALIDATED
ELOVL7 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-541s21c1
Sequence:CCGGATCGAGCTGTTAGACACTATCCTCGAGGATAGTGTCTAACAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-459s21c1
Sequence:CCGGATGTGACATTGTTGACTATTCCTCGAGGAATAGTCAACAATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029001.5-1238s21c1
Sequence:CCGGACCAATCAGAGGTCTTAATACCTCGAGGTATTAAGACCTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-716s21c1
Sequence:CCGGTGTATTCTTACTATGGGTTATCTCGAGATAACCCATAGTAAGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-1320s21c1
Sequence:CCGGTGATGACAAATACTAGCTATTCTCGAGAATAGCTAGTATTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029001.2-201s1c1
Sequence:CCGGGATCCGAGATTTGAAGACTATCTCGAGATAGTCTTCAAATCTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029001.2-324s1c1
Sequence:CCGGGAACTCAAGAAAGCGATGATACTCGAGTATCATCGCTTTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029001.2-429s1c1
Sequence:CCGGCGATGTGACATTGTTGACTATCTCGAGATAGTCAACAATGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-2854s1c1
Sequence:CCGGCCACAGTCTTAACTATATGAACTCGAGTTCATATAGTTAAGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3079s1c1
Sequence:CCGGCCAGGCTATTAAGTATAGTTTCTCGAGAAACTATACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3078s1c1
Sequence:CCGGCCCAGGCTATTAAGTATAGTTCTCGAGAACTATACTTAATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029001
VALIDATED
ELOVL7 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-541s21c1
Sequence:CCGGATCGAGCTGTTAGACACTATCCTCGAGGATAGTGTCTAACAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-459s21c1
Sequence:CCGGATGTGACATTGTTGACTATTCCTCGAGGAATAGTCAACAATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029001.5-1238s21c1
Sequence:CCGGACCAATCAGAGGTCTTAATACCTCGAGGTATTAAGACCTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-716s21c1
Sequence:CCGGTGTATTCTTACTATGGGTTATCTCGAGATAACCCATAGTAAGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-1320s21c1
Sequence:CCGGTGATGACAAATACTAGCTATTCTCGAGAATAGCTAGTATTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029001.2-201s1c1
Sequence:CCGGGATCCGAGATTTGAAGACTATCTCGAGATAGTCTTCAAATCTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029001.2-324s1c1
Sequence:CCGGGAACTCAAGAAAGCGATGATACTCGAGTATCATCGCTTTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029001.2-429s1c1
Sequence:CCGGCGATGTGACATTGTTGACTATCTCGAGATAGTCAACAATGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-2854s1c1
Sequence:CCGGCCACAGTCTTAACTATATGAACTCGAGTTCATATAGTTAAGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3079s1c1
Sequence:CCGGCCAGGCTATTAAGTATAGTTTCTCGAGAAACTATACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3078s1c1
Sequence:CCGGCCCAGGCTATTAAGTATAGTTCTCGAGAACTATACTTAATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029001
VALIDATED
ELOVL7 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-541s21c1
Sequence:CCGGATCGAGCTGTTAGACACTATCCTCGAGGATAGTGTCTAACAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-459s21c1
Sequence:CCGGATGTGACATTGTTGACTATTCCTCGAGGAATAGTCAACAATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029001.5-1238s21c1
Sequence:CCGGACCAATCAGAGGTCTTAATACCTCGAGGTATTAAGACCTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-716s21c1
Sequence:CCGGTGTATTCTTACTATGGGTTATCTCGAGATAACCCATAGTAAGAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029001.5-1320s21c1
Sequence:CCGGTGATGACAAATACTAGCTATTCTCGAGAATAGCTAGTATTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029001.2-201s1c1
Sequence:CCGGGATCCGAGATTTGAAGACTATCTCGAGATAGTCTTCAAATCTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029001.2-324s1c1
Sequence:CCGGGAACTCAAGAAAGCGATGATACTCGAGTATCATCGCTTTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029001.2-429s1c1
Sequence:CCGGCGATGTGACATTGTTGACTATCTCGAGATAGTCAACAATGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-2854s1c1
Sequence:CCGGCCACAGTCTTAACTATATGAACTCGAGTTCATATAGTTAAGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3079s1c1
Sequence:CCGGCCAGGCTATTAAGTATAGTTTCTCGAGAAACTATACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029001.2-3078s1c1
Sequence:CCGGCCCAGGCTATTAAGTATAGTTCTCGAGAACTATACTTAATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024930
VALIDATED
ELOVL7 MISSION shRNA Bacterial Glycerol Stock
ELOVL fatty acid elongase 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-282s1c1
Sequence:CCGGTGTCACTTCCTTGGGACCAAACTCGAGTTTGGTCCCAAGGAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-328s1c1
Sequence:CCGGGAACTCAAGAAAGCAATGATACTCGAGTATCATTGCTTTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-780s1c1
Sequence:CCGGCCAGTTTGTTATTGTCGCCATCTCGAGATGGCGACAATAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-2895s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-611s1c1
Sequence:CCGGCCTGGTGGTTTGGAGTCAAATCTCGAGATTTGACTCCAAACCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024930
VALIDATED
ELOVL7 MISSION shRNA shRNA Plasmid DNA
ELOVL fatty acid elongase 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-282s1c1
Sequence:CCGGTGTCACTTCCTTGGGACCAAACTCGAGTTTGGTCCCAAGGAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-328s1c1
Sequence:CCGGGAACTCAAGAAAGCAATGATACTCGAGTATCATTGCTTTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-780s1c1
Sequence:CCGGCCAGTTTGTTATTGTCGCCATCTCGAGATGGCGACAATAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-2895s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-611s1c1
Sequence:CCGGCCTGGTGGTTTGGAGTCAAATCTCGAGATTTGACTCCAAACCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024930
VALIDATED
ELOVL7 MISSION shRNA Lentiviral Transduction Particles
ELOVL fatty acid elongase 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-282s1c1
Sequence:CCGGTGTCACTTCCTTGGGACCAAACTCGAGTTTGGTCCCAAGGAAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-328s1c1
Sequence:CCGGGAACTCAAGAAAGCAATGATACTCGAGTATCATTGCTTTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-780s1c1
Sequence:CCGGCCAGTTTGTTATTGTCGCCATCTCGAGATGGCGACAATAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-2895s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024930.1-611s1c1
Sequence:CCGGCCTGGTGGTTTGGAGTCAAATCTCGAGATTTGACTCCAAACCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks