EMAIL THIS PAGE TO A FRIEND

ELP2

elongator acetyltransferase complex subunit 2

115 Gene Product Result for
Synonyms: SHINC-2 STATIP1 StIP
Gene ID:
Mouse(58523) elongator acetyltransferase complex subunit 2
Rat(307545) elongator acetyltransferase complex subunit 2
Zebrafish(560338) elongation protein 2 homolog (S. cerevisiae)
fruit fly(36123) Elongator complex protein 2
chicken(420980) elongation protein 2 homolog (S. cerevisiae)
domestic cat(101095620) elongator acetyltransferase complex subunit 2
cow(511041) elongation protein 2 homolog (S. cerevisiae)
Horse(100052939) elongator acetyltransferase complex subunit 2
dog(480158) elongator acetyltransferase complex subunit 2
Thale Cress(841378) elongator protein 2
domestic guinea pig(100731487) elongator acetyltransferase complex subunit 2
naked mole-rat(101713265) elongator acetyltransferase complex subunit 2
sheep(101107058) elongator acetyltransferase complex subunit 2
Domestic Rabbit(100352669) elongator acetyltransferase complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018255 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018255 Rosetta Predictions human pricing
NM_001034145 Rosetta Predictions rat pricing
NM_021448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351608 predicted 526
2 SASI_Hs01_00155271 predicted 1610
3 SASI_Hs01_00155272 predicted 1569
4 SASI_Hs01_00155274 predicted 1761
5 SASI_Hs01_00155275 predicted 1504
6 SASI_Hs01_00155276 predicted 689
7 SASI_Hs02_00351609 predicted 1340
8 SASI_Hs01_00155278 predicted 2120
9 SASI_Hs02_00351610 predicted 1327
10 SASI_Hs02_00351611 predicted 409
11 SASI_Hs01_00155269 predicted 928
12 SASI_Hs01_00155270 predicted 2252
13 SASI_Hs01_00155273 predicted 1875
14 SASI_Hs01_00155277 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121535 predicted 2451
2 SASI_Rn01_00121536 predicted 405
3 SASI_Rn01_00121537 predicted 1949
4 SASI_Rn02_00203998 predicted 2321
5 SASI_Rn01_00121538 predicted 702
6 SASI_Rn01_00121539 predicted 574
7 SASI_Rn01_00121540 predicted 350
8 SASI_Rn01_00121542 predicted 2053
9 SASI_Rn02_00203999 predicted 454
10 SASI_Rn01_00121543 predicted 1798
11 SASI_Rn01_00121541 predicted 1346
12 SASI_Rn01_00121544 predicted 2444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158089 predicted 2245
2 SASI_Mm02_00326094 predicted 1357
3 SASI_Mm01_00158092 predicted 2062
4 SASI_Mm01_00158093 predicted 2231
5 SASI_Mm02_00326095 predicted 1350
6 SASI_Mm01_00158094 predicted 352
7 SASI_Mm01_00158095 predicted 413
8 SASI_Mm01_00158096 predicted 1735
9 SASI_Mm02_00326096 predicted 1486
10 SASI_Mm02_00326097 predicted 1408
11 SASI_Mm01_00158090 predicted 1677
12 SASI_Mm01_00158091 predicted 740
13 SASI_Mm01_00158097 predicted 651
14 SASI_Mm01_00158098 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021448
VALIDATED
ELP2 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-2330s1c1
Sequence:CCGGGCCTGGGTATCAGAAGGTTATCTCGAGATAACCTTCTGATACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-511s1c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-1512s1c1
Sequence:CCGGGCTGTCAAATAAAGCTCTCTTCTCGAGAAGAGAGCTTTATTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-2091s1c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-545s21c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021448.2-2596s21c1
Sequence:CCGGCTTTACCTTCGTGATTGATTGCTCGAGCAATCAATCACGAAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-364s21c1
Sequence:CCGGTTGTGCTGTGCACGCTATTTACTCGAGTAAATAGCGTGCACAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-714s21c1
Sequence:CCGGGCTCACAGGACTGCCTAATAACTCGAGTTATTAGGCAGTCCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-2125s21c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021448
VALIDATED
ELP2 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-2330s1c1
Sequence:CCGGGCCTGGGTATCAGAAGGTTATCTCGAGATAACCTTCTGATACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-511s1c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-1512s1c1
Sequence:CCGGGCTGTCAAATAAAGCTCTCTTCTCGAGAAGAGAGCTTTATTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-2091s1c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-545s21c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021448.2-2596s21c1
Sequence:CCGGCTTTACCTTCGTGATTGATTGCTCGAGCAATCAATCACGAAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-364s21c1
Sequence:CCGGTTGTGCTGTGCACGCTATTTACTCGAGTAAATAGCGTGCACAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-714s21c1
Sequence:CCGGGCTCACAGGACTGCCTAATAACTCGAGTTATTAGGCAGTCCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-2125s21c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021448
VALIDATED
ELP2 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-2330s1c1
Sequence:CCGGGCCTGGGTATCAGAAGGTTATCTCGAGATAACCTTCTGATACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021448.1-511s1c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-1512s1c1
Sequence:CCGGGCTGTCAAATAAAGCTCTCTTCTCGAGAAGAGAGCTTTATTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021448.1-2091s1c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-545s21c1
Sequence:CCGGCCTGGTACTAATGTGCCAGTACTCGAGTACTGGCACATTAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021448.2-2596s21c1
Sequence:CCGGCTTTACCTTCGTGATTGATTGCTCGAGCAATCAATCACGAAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-364s21c1
Sequence:CCGGTTGTGCTGTGCACGCTATTTACTCGAGTAAATAGCGTGCACAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-714s21c1
Sequence:CCGGGCTCACAGGACTGCCTAATAACTCGAGTTATTAGGCAGTCCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021448.2-2125s21c1
Sequence:CCGGCGAGTGTAAGTCCAGCCATAACTCGAGTTATGGCTGGACTTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018255
VALIDATED
ELP2 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018255.1-1532s1c1
Sequence:CCGGGCTGTCTTTCAGGGAGATATACTCGAGTATATCTCCCTGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2334s1c1
Sequence:CCGGGCCAAAGTCATACACTGGCTACTCGAGTAGCCAGTGTATGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2220s1c1
Sequence:CCGGGATACGTGGTTGCAGTAGGATCTCGAGATCCTACTGCAACCACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-2335s1c1
Sequence:CCGGCCAAAGTCATACACTGGCTATCTCGAGATAGCCAGTGTATGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018255.1-1071s1c1
Sequence:CCGGCCATGATCATTGCTCATGCTTCTCGAGAAGCATGAGCAATGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-1148s1c1
Sequence:CCGGCCAGAGATTGTCATTTCAGGACTCGAGTCCTGAAATGACAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-1507s1c1
Sequence:CCGGCCCTGCATTGGGATTATCAAACTCGAGTTTGATAATCCCAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-2041s21c1
Sequence:CCGGGAGTCCTGACAGCAAGTATTTCTCGAGAAATACTTGCTGTCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-369s21c1
Sequence:CCCGGGACATCAGATCCTGCATTATCTCGAGATAATGCAGGATCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-340s21c1
Sequence:CCGGTTATGCGGTGCATGCTGTTTACTCGAGTAAACAGCATGCACCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018255
VALIDATED
ELP2 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018255.1-1532s1c1
Sequence:CCGGGCTGTCTTTCAGGGAGATATACTCGAGTATATCTCCCTGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2334s1c1
Sequence:CCGGGCCAAAGTCATACACTGGCTACTCGAGTAGCCAGTGTATGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2220s1c1
Sequence:CCGGGATACGTGGTTGCAGTAGGATCTCGAGATCCTACTGCAACCACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-2335s1c1
Sequence:CCGGCCAAAGTCATACACTGGCTATCTCGAGATAGCCAGTGTATGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018255.1-1071s1c1
Sequence:CCGGCCATGATCATTGCTCATGCTTCTCGAGAAGCATGAGCAATGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-1148s1c1
Sequence:CCGGCCAGAGATTGTCATTTCAGGACTCGAGTCCTGAAATGACAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-1507s1c1
Sequence:CCGGCCCTGCATTGGGATTATCAAACTCGAGTTTGATAATCCCAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-2041s21c1
Sequence:CCGGGAGTCCTGACAGCAAGTATTTCTCGAGAAATACTTGCTGTCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-369s21c1
Sequence:CCCGGGACATCAGATCCTGCATTATCTCGAGATAATGCAGGATCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-340s21c1
Sequence:CCGGTTATGCGGTGCATGCTGTTTACTCGAGTAAACAGCATGCACCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018255
VALIDATED
ELP2 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018255.1-1532s1c1
Sequence:CCGGGCTGTCTTTCAGGGAGATATACTCGAGTATATCTCCCTGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2334s1c1
Sequence:CCGGGCCAAAGTCATACACTGGCTACTCGAGTAGCCAGTGTATGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-2220s1c1
Sequence:CCGGGATACGTGGTTGCAGTAGGATCTCGAGATCCTACTGCAACCACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-2335s1c1
Sequence:CCGGCCAAAGTCATACACTGGCTATCTCGAGATAGCCAGTGTATGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018255.1-1071s1c1
Sequence:CCGGCCATGATCATTGCTCATGCTTCTCGAGAAGCATGAGCAATGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018255.1-1148s1c1
Sequence:CCGGCCAGAGATTGTCATTTCAGGACTCGAGTCCTGAAATGACAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018255.1-1507s1c1
Sequence:CCGGCCCTGCATTGGGATTATCAAACTCGAGTTTGATAATCCCAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-2041s21c1
Sequence:CCGGGAGTCCTGACAGCAAGTATTTCTCGAGAAATACTTGCTGTCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-369s21c1
Sequence:CCCGGGACATCAGATCCTGCATTATCTCGAGATAATGCAGGATCTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018255.1-340s21c1
Sequence:CCGGTTATGCGGTGCATGCTGTTTACTCGAGTAAACAGCATGCACCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks