EMAIL THIS PAGE TO A FRIEND

ELP3

elongator acetyltransferase complex subunit 3

Synonyms: KAT9
UniProtKB ID: Q9H9T3, Q53G84, Q6AWB0, Q9BVF7, Q9NVZ1
Gene ID:
Human(55140) Summary: ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]
Mouse(74195) elongator acetyltransferase complex subunit 3
Rat(361058) elongation protein 3 homolog (S. cerevisiae)
sheep(101115183) elongator acetyltransferase complex subunit 3
Domestic Rabbit(100349730) elongator acetyltransferase complex subunit 3
naked mole-rat(101722310) elongator acetyltransferase complex subunit 3
domestic guinea pig(100735608) elongator acetyltransferase complex subunit 3
Zebrafish(541509) elongation protein 3 homolog (S. cerevisiae)
fruit fly(33649) Elongator complex protein 3
cow(784720) elongation protein 3 homolog (S. cerevisiae)
Horse(100054680) elongator acetyltransferase complex subunit 3
domestic cat(101093850) elongator acetyltransferase complex subunit 3
dog(477370) elongator acetyltransferase complex subunit 3
chicken(422021) elongation protein 3 homolog (S. cerevisiae)
Gene Class: ATPase
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018091 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018091 Rosetta Predictions human pricing
NM_028811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198399 predicted 630
2 SASI_Hs02_00351270 predicted 253
3 SASI_Hs01_00198401 predicted 1258
4 SASI_Hs01_00198402 predicted 587
5 SASI_Hs01_00198403 predicted 1359
6 SASI_Hs01_00198404 predicted 790
7 SASI_Hs01_00198405 predicted 1520
8 SASI_Hs01_00198406 predicted 830
9 SASI_Hs01_00198407 predicted 717
10 SASI_Hs02_00351271 predicted 563
11 SASI_Hs01_00198400 predicted 1268
12 SASI_Hs01_00198408 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129238 predicted 896
2 SASI_Mm01_00129239 predicted 696
3 SASI_Mm01_00129240 predicted 1597
4 SASI_Mm01_00129241 predicted 616
5 SASI_Mm01_00129243 predicted 1250
6 SASI_Mm02_00334426 predicted 581
7 SASI_Mm01_00129245 predicted 1266
8 SASI_Mm01_00129246 predicted 705
9 SASI_Mm01_00129247 predicted 544
10 SASI_Mm02_00334427 predicted 294
11 SASI_Mm01_00129242 predicted 582
12 SASI_Mm01_00129244 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028811
VALIDATED
ELP3 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-424s21c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-115s21c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1280s21c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1584s21c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-202s21c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-1280s1c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-115s1c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-424s1c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-202s1c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028811.1-1584s1c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028811
VALIDATED
ELP3 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-424s21c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-115s21c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1280s21c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1584s21c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-202s21c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-1280s1c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-115s1c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-424s1c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-202s1c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028811.1-1584s1c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028811
VALIDATED
ELP3 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-424s21c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-115s21c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1280s21c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-1584s21c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028811.2-202s21c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-1280s1c1
Sequence:CCGGCGGAGAGATTATGTTGCCAATCTCGAGATTGGCAACATAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-115s1c1
Sequence:CCGGCGTCGATCTAAATAAGATGAACTCGAGTTCATCTTATTTAGATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-424s1c1
Sequence:CCGGCCGTGCTAGATATGACCCTTTCTCGAGAAAGGGTCATATCTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028811.1-202s1c1
Sequence:CCGGCCCTCCTCACTATCGAAAGATCTCGAGATCTTTCGATAGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028811.1-1584s1c1
Sequence:CCGGGCACAAGAAATTATTACCGAACTCGAGTTCGGTAATAATTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018091
VALIDATED
ELP3 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-653s21c1
Sequence:CCGGGTGATGGGTGGAACGTTTATGCTCGAGCATAAACGTTCCACCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-2120s21c1
Sequence:CCGGCACCATAACTCATGCAATAAACTCGAGTTTATTGCATGAGTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-1236s21c1
Sequence:CCGGACCGAGTACAGAGGGATATTCCTCGAGGAATATCCCTCTGTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-823s21c1
Sequence:CCGGTTACTGCATGAAGCGACATTTCTCGAGAAATGTCGCTTCATGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018091.5-751s21c1
Sequence:CCGGTTACGAGGCAGTCAAGTATTCCTCGAGGAATACTTGACTGCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-424s1c1
Sequence:CCGGGCCAGATATGACCCTTTCCTACTCGAGTAGGAAAGGGTCATATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018091.x-441s1c1
Sequence:CCGGCCTACAGACAAGACACCGAATCTCGAGATTCGGTGTCTTGTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-1360s1c1
Sequence:CCGGCGATTACGCAAGTGTTCAGAACTCGAGTTCTGAACACTTGCGTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-879s1c1
Sequence:CCGGCGTGGGACTAGAAAGAGACATCTCGAGATGTCTCTTTCTAGTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018091
VALIDATED
ELP3 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-653s21c1
Sequence:CCGGGTGATGGGTGGAACGTTTATGCTCGAGCATAAACGTTCCACCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-2120s21c1
Sequence:CCGGCACCATAACTCATGCAATAAACTCGAGTTTATTGCATGAGTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-1236s21c1
Sequence:CCGGACCGAGTACAGAGGGATATTCCTCGAGGAATATCCCTCTGTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-823s21c1
Sequence:CCGGTTACTGCATGAAGCGACATTTCTCGAGAAATGTCGCTTCATGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018091.5-751s21c1
Sequence:CCGGTTACGAGGCAGTCAAGTATTCCTCGAGGAATACTTGACTGCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-424s1c1
Sequence:CCGGGCCAGATATGACCCTTTCCTACTCGAGTAGGAAAGGGTCATATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018091.x-441s1c1
Sequence:CCGGCCTACAGACAAGACACCGAATCTCGAGATTCGGTGTCTTGTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-1360s1c1
Sequence:CCGGCGATTACGCAAGTGTTCAGAACTCGAGTTCTGAACACTTGCGTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-879s1c1
Sequence:CCGGCGTGGGACTAGAAAGAGACATCTCGAGATGTCTCTTTCTAGTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018091
VALIDATED
ELP3 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-653s21c1
Sequence:CCGGGTGATGGGTGGAACGTTTATGCTCGAGCATAAACGTTCCACCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-2120s21c1
Sequence:CCGGCACCATAACTCATGCAATAAACTCGAGTTTATTGCATGAGTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-1236s21c1
Sequence:CCGGACCGAGTACAGAGGGATATTCCTCGAGGAATATCCCTCTGTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018091.5-823s21c1
Sequence:CCGGTTACTGCATGAAGCGACATTTCTCGAGAAATGTCGCTTCATGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018091.5-751s21c1
Sequence:CCGGTTACGAGGCAGTCAAGTATTCCTCGAGGAATACTTGACTGCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-424s1c1
Sequence:CCGGGCCAGATATGACCCTTTCCTACTCGAGTAGGAAAGGGTCATATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018091.x-441s1c1
Sequence:CCGGCCTACAGACAAGACACCGAATCTCGAGATTCGGTGTCTTGTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-1360s1c1
Sequence:CCGGCGATTACGCAAGTGTTCAGAACTCGAGTTCTGAACACTTGCGTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018091.x-879s1c1
Sequence:CCGGCGTGGGACTAGAAAGAGACATCTCGAGATGTCTCTTTCTAGTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks