EMAIL THIS PAGE TO A FRIEND

ELP4

elongator acetyltransferase complex subunit 4

55 Gene Product Result for
Synonyms: C11orf19 PAX6NEB PAXNEB dJ68P15A.1
UniProtKB ID: Q96EB1, Q9H4E8, Q9NX11
Gene ID:
Human(26610) Summary: This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(77766) elongation protein 4 homolog (S. cerevisiae)
Rat(691133) elongation protein 4 homolog (S. cerevisiae)
Zebrafish(550331) elongation protein 4 homolog (S. cerevisiae)
domestic cat(101086750) elongator acetyltransferase complex subunit 4
dog(483442) elongator acetyltransferase complex subunit 4
cow(614139) elongator acetyltransferase complex subunit 4
chicken(428603) elongation protein 4 homolog (S. cerevisiae)
domestic guinea pig(100727091) elongator acetyltransferase complex subunit 4
naked mole-rat(101711420) elongator acetyltransferase complex subunit 4
sheep(101119754) elongator acetyltransferase complex subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072501 MISSION® esiRNA esiRNA human ELP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019040 Rosetta Predictions human pricing
NM_023876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185603 predicted 356
2 SASI_Hs02_00352602 predicted 917
3 SASI_Hs01_00185605 predicted 349
4 SASI_Hs02_00352603 predicted 1043
5 SASI_Hs01_00185606 predicted 702
6 SASI_Hs01_00185607 predicted 490
7 SASI_Hs01_00185608 predicted 607
8 SASI_Hs01_00185609 predicted 659
9 SASI_Hs01_00185610 predicted 242
10 SASI_Hs01_00185611 predicted 563
11 SASI_Hs01_00185602 predicted 544
12 SASI_Hs01_00185604 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066694 predicted 1080
2 SASI_Mm01_00066695 predicted 397
3 SASI_Mm01_00066696 predicted 339
4 SASI_Mm01_00066697 predicted 587
5 SASI_Mm01_00066698 predicted 234
6 SASI_Mm01_00066699 predicted 539
7 SASI_Mm01_00066700 predicted 220
8 SASI_Mm01_00066701 predicted 1034
9 SASI_Mm01_00066702 predicted 318
10 SASI_Mm01_00066703 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019040
VALIDATED
ELP4 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-1869s1c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-493s1c1
Sequence:CCGGGCGTTACCAGTTATTACCCAACTCGAGTTGGGTAATAACTGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-1009s1c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-860s1c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019040.x-1460s1c1
Sequence:CCGGGAGACAAGAGAGGAACATTTACTCGAGTAAATGTTCCTCTCTTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1037s21c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019040.3-567s21c1
Sequence:CCGGTCAAGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1469s21c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1088s21c1
Sequence:CCGGGCAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-888s21c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019040
VALIDATED
ELP4 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-1869s1c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-493s1c1
Sequence:CCGGGCGTTACCAGTTATTACCCAACTCGAGTTGGGTAATAACTGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-1009s1c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-860s1c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019040.x-1460s1c1
Sequence:CCGGGAGACAAGAGAGGAACATTTACTCGAGTAAATGTTCCTCTCTTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1037s21c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019040.3-567s21c1
Sequence:CCGGTCAAGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1469s21c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1088s21c1
Sequence:CCGGGCAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-888s21c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019040
VALIDATED
ELP4 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-1869s1c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_019040.x-493s1c1
Sequence:CCGGGCGTTACCAGTTATTACCCAACTCGAGTTGGGTAATAACTGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-1009s1c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019040.x-860s1c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019040.x-1460s1c1
Sequence:CCGGGAGACAAGAGAGGAACATTTACTCGAGTAAATGTTCCTCTCTTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1037s21c1
Sequence:CCGGGAGAGAAACTAACCCATTGTACTCGAGTACAATGGGTTAGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019040.3-567s21c1
Sequence:CCGGTCAAGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1469s21c1
Sequence:CCGGCAGAACTAGCACAGCAGAAATCTCGAGATTTCTGCTGTGCTAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-1088s21c1
Sequence:CCGGGCAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019040.3-888s21c1
Sequence:CCGGCTCTATGTTCTCCGTGGTCTTCTCGAGAAGACCACGGAGAACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023876
VALIDATED
ELP4 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.2-920s1c1
Sequence:CCGGGCACATCTTGTCCAGAATAAACTCGAGTTTATTCTGGACAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023876.2-3199s1c1
Sequence:CCGGCCCTTGAAATTGAGTGAACATCTCGAGATGTTCACTCAATTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-1009s1c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-467s1c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023876.2-848s1c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023876.2-3736s1c1
Sequence:CCGGCCTTTCCTTAACATGGGTAAACTCGAGTTTACCCATGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-1293s21c1
Sequence:CCGGAGTCACCGAGTGCGAAGTTATCTCGAGATAACTTCGCACTCGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-466s21c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-847s21c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-1059s1c1
Sequence:CCGGGAAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-628s1c1
Sequence:CCGGCACATCTCTCCAGATCTTAAACTCGAGTTTAAGATCTGGAGAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-538s21c1
Sequence:CCGGTCACGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023876.3-1008s21c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023876
VALIDATED
ELP4 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.2-920s1c1
Sequence:CCGGGCACATCTTGTCCAGAATAAACTCGAGTTTATTCTGGACAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023876.2-3199s1c1
Sequence:CCGGCCCTTGAAATTGAGTGAACATCTCGAGATGTTCACTCAATTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-1009s1c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-467s1c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023876.2-848s1c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023876.2-3736s1c1
Sequence:CCGGCCTTTCCTTAACATGGGTAAACTCGAGTTTACCCATGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-1293s21c1
Sequence:CCGGAGTCACCGAGTGCGAAGTTATCTCGAGATAACTTCGCACTCGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-466s21c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-847s21c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-1059s1c1
Sequence:CCGGGAAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-628s1c1
Sequence:CCGGCACATCTCTCCAGATCTTAAACTCGAGTTTAAGATCTGGAGAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-538s21c1
Sequence:CCGGTCACGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023876.3-1008s21c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023876
VALIDATED
ELP4 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.2-920s1c1
Sequence:CCGGGCACATCTTGTCCAGAATAAACTCGAGTTTATTCTGGACAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023876.2-3199s1c1
Sequence:CCGGCCCTTGAAATTGAGTGAACATCTCGAGATGTTCACTCAATTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-1009s1c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023876.2-467s1c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023876.2-848s1c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023876.2-3736s1c1
Sequence:CCGGCCTTTCCTTAACATGGGTAAACTCGAGTTTACCCATGTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-1293s21c1
Sequence:CCGGAGTCACCGAGTGCGAAGTTATCTCGAGATAACTTCGCACTCGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-466s21c1
Sequence:CCGGCCTAATGTCAACATGAAGATACTCGAGTATCTTCATGTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-847s21c1
Sequence:CCGGCTTACCAAGTTCCTCTACATTCTCGAGAATGTAGAGGAACTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-1059s1c1
Sequence:CCGGGAAGATTCCTCGGCTTAATAACTCGAGTTATTAAGCCGAGGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023876.3-628s1c1
Sequence:CCGGCACATCTCTCCAGATCTTAAACTCGAGTTTAAGATCTGGAGAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023876.3-538s21c1
Sequence:CCGGTCACGATTTGGTCACTATTATCTCGAGATAATAGTGACCAAATCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023876.3-1008s21c1
Sequence:CCGGGAGAGAGACTAACCCATTGTACTCGAGTACAATGGGTTAGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks