EMAIL THIS PAGE TO A FRIEND

ELP5

elongator acetyltransferase complex subunit 5

164 Gene Product Result for
Synonyms: C17orf81 DERP6 MST071 MSTP071
Gene ID:
Mouse(54351) elongator acetyltransferase complex subunit 5
Rat(287446) elongator acetyltransferase complex subunit 5
sheep(101117858) elongator acetyltransferase complex subunit 5
naked mole-rat(101712786) elongator acetyltransferase complex subunit 5
domestic guinea pig(100717174) elongator acetyltransferase complex subunit 5
Zebrafish(790921) elongator acetyltransferase complex subunit 5
cow(512976) elongator acetyltransferase complex subunit 5
domestic cat(101095778) elongator acetyltransferase complex subunit 5
dog(479480) elongator acetyltransferase complex subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015362 Rosetta Predictions human pricing
NM_203413 Rosetta Predictions human pricing
NM_203414 Rosetta Predictions human pricing
NM_203415 Rosetta Predictions human pricing
NM_001001718 Rosetta Predictions rat pricing
NM_018740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113437 predicted 672
2 SASI_Hs01_00113438 predicted 368
3 SASI_Hs01_00113439 predicted 417
4 SASI_Hs01_00113441 predicted 417
5 SASI_Hs01_00113442 predicted 534
6 SASI_Hs01_00113443 predicted 530
7 SASI_Hs02_00347697 predicted 618
8 SASI_Hs01_00113444 predicted 348
9 SASI_Hs02_00347698 predicted 503
10 SASI_Hs01_00113446 predicted 518
11 SASI_Hs01_00113440 predicted 668
12 SASI_Hs01_00113445 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051219 predicted 675
2 SASI_Hs01_00051220 predicted 368
3 SASI_Hs01_00051221 predicted 417
4 SASI_Hs01_00051223 predicted 415
5 SASI_Hs01_00051224 predicted 541
6 SASI_Hs01_00051225 predicted 535
7 SASI_Hs02_00373343 predicted 618
8 SASI_Hs01_00051226 predicted 346
9 SASI_Hs02_00373344 predicted 504
10 SASI_Hs01_00051228 predicted 517
11 SASI_Hs01_00051222 predicted 661
12 SASI_Hs01_00051227 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057749 predicted 764
2 SASI_Hs01_00057750 predicted 457
3 SASI_Hs01_00057751 predicted 505
4 SASI_Hs01_00057753 predicted 502
5 SASI_Hs01_00057754 predicted 627
6 SASI_Hs01_00057755 predicted 624
7 SASI_Hs02_00373345 predicted 708
8 SASI_Hs01_00057756 predicted 431
9 SASI_Hs02_00373346 predicted 585
10 SASI_Hs01_00057758 predicted 607
11 SASI_Hs01_00057752 predicted 755
12 SASI_Hs01_00057757 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016486 predicted 597
2 SASI_Hs01_00016487 predicted 293
3 SASI_Hs01_00016488 predicted 334
4 SASI_Hs01_00016490 predicted 339
5 SASI_Hs01_00016491 predicted 462
6 SASI_Hs01_00016492 predicted 458
7 SASI_Hs02_00373347 predicted 544
8 SASI_Hs01_00016493 predicted 271
9 SASI_Hs02_00373348 predicted 420
10 SASI_Hs01_00016495 predicted 440
11 SASI_Hs01_00016489 predicted 588
12 SASI_Hs01_00016494 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042622 predicted 762
2 SASI_Rn01_00042624 predicted 251
3 SASI_Rn01_00042625 predicted 1144
4 SASI_Rn01_00042626 predicted 943
5 SASI_Rn01_00042627 predicted 962
6 SASI_Rn01_00042628 predicted 638
7 SASI_Rn01_00042629 predicted 211
8 SASI_Rn01_00042630 predicted 434
9 SASI_Rn01_00042631 predicted 748
10 SASI_Rn02_00197934 predicted 957
11 SASI_Rn01_00042623 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174721 predicted 406
2 SASI_Mm01_00174722 predicted 394
3 SASI_Mm01_00174723 predicted 911
4 SASI_Mm01_00174725 predicted 426
5 SASI_Mm01_00174726 predicted 1126
6 SASI_Mm02_00323993 predicted 943
7 SASI_Mm01_00174727 predicted 319
8 SASI_Mm01_00174728 predicted 555
9 SASI_Mm01_00174729 predicted 432
10 SASI_Mm01_00174730 predicted 768
11 SASI_Mm01_00174724 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015362
VALIDATED
ELP5 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1062s21c2
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-925s21c2
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015362.3-1186s21c2
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1084s21c2
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1054s1c1
Sequence:CCGGGCTACCAGCCACATCTTCTATCTCGAGATAGAAGATGTGGCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-925s1c1
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-1084s1c1
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1062s1c1
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-954s1c1
Sequence:CCGGCCTGTCCAAGAAAGAGAGAGACTCGAGTCTCTCTCTTTCTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1077s1c1
Sequence:CCGGGCCAGATGCTTATGATGACCTCTCGAGAGGTCATCATAAGCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-406s1c1
Sequence:CCGGGATATCAACAATCGGCTGGTTCTCGAGAACCAGCCGATTGTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1186s1c1
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015362
VALIDATED
ELP5 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1062s21c2
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-925s21c2
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015362.3-1186s21c2
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1084s21c2
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1054s1c1
Sequence:CCGGGCTACCAGCCACATCTTCTATCTCGAGATAGAAGATGTGGCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-925s1c1
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-1084s1c1
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1062s1c1
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-954s1c1
Sequence:CCGGCCTGTCCAAGAAAGAGAGAGACTCGAGTCTCTCTCTTTCTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1077s1c1
Sequence:CCGGGCCAGATGCTTATGATGACCTCTCGAGAGGTCATCATAAGCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-406s1c1
Sequence:CCGGGATATCAACAATCGGCTGGTTCTCGAGAACCAGCCGATTGTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1186s1c1
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015362
VALIDATED
ELP5 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1062s21c2
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-925s21c2
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015362.3-1186s21c2
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015362.3-1084s21c2
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1054s1c1
Sequence:CCGGGCTACCAGCCACATCTTCTATCTCGAGATAGAAGATGTGGCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-925s1c1
Sequence:CCGGCCCACAACTCATTTGACCTTTCTCGAGAAAGGTCAAATGAGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-1084s1c1
Sequence:CCGGGCTTATGATGACCTGGACCAACTCGAGTTGGTCCAGGTCATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1062s1c1
Sequence:CCGGCCACATCTTCTATGAGCCAGACTCGAGTCTGGCTCATAGAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-954s1c1
Sequence:CCGGCCTGTCCAAGAAAGAGAGAGACTCGAGTCTCTCTCTTTCTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015362.3-1077s1c1
Sequence:CCGGGCCAGATGCTTATGATGACCTCTCGAGAGGTCATCATAAGCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015362.3-406s1c1
Sequence:CCGGGATATCAACAATCGGCTGGTTCTCGAGAACCAGCCGATTGTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015362.3-1186s1c1
Sequence:CCGGGCCCAGAACCATCTTTCTATTCTCGAGAATAGAAAGATGGTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018740
VALIDATED
ELP5 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1088s1c1
Sequence:CCGGCTTCTATGAGCCAGATGCTTTCTCGAGAAAGCATCTGGCTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-657s1c1
Sequence:CCGGCCAGGTGATAACTCCCTAGTACTCGAGTACTAGGGAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-603s1c1
Sequence:CCGGCCCTGTGTTACACTCTGTCAACTCGAGTTGACAGAGTGTAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1131s1c1
Sequence:CCGGCCAGATGATGACCTAGATATTCTCGAGAATATCTAGGTCATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018740.1-1221s1c1
Sequence:CCGGCCTTGTCCTTTGTTACTTTGTCTCGAGACAAAGTAACAAAGGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018740.1-1215s1c1
Sequence:CCGGCTTGTCCCTTGTCCTTTGTTACTCGAGTAACAAAGGACAAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-336s1c1
Sequence:CCGGCTTATCAAGAAATCTGCACTTCTCGAGAAGTGCAGATTTCTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018740
VALIDATED
ELP5 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1088s1c1
Sequence:CCGGCTTCTATGAGCCAGATGCTTTCTCGAGAAAGCATCTGGCTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-657s1c1
Sequence:CCGGCCAGGTGATAACTCCCTAGTACTCGAGTACTAGGGAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-603s1c1
Sequence:CCGGCCCTGTGTTACACTCTGTCAACTCGAGTTGACAGAGTGTAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1131s1c1
Sequence:CCGGCCAGATGATGACCTAGATATTCTCGAGAATATCTAGGTCATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018740.1-1221s1c1
Sequence:CCGGCCTTGTCCTTTGTTACTTTGTCTCGAGACAAAGTAACAAAGGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018740.1-1215s1c1
Sequence:CCGGCTTGTCCCTTGTCCTTTGTTACTCGAGTAACAAAGGACAAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-336s1c1
Sequence:CCGGCTTATCAAGAAATCTGCACTTCTCGAGAAGTGCAGATTTCTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018740
VALIDATED
ELP5 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1088s1c1
Sequence:CCGGCTTCTATGAGCCAGATGCTTTCTCGAGAAAGCATCTGGCTCATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-657s1c1
Sequence:CCGGCCAGGTGATAACTCCCTAGTACTCGAGTACTAGGGAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-603s1c1
Sequence:CCGGCCCTGTGTTACACTCTGTCAACTCGAGTTGACAGAGTGTAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018740.1-1131s1c1
Sequence:CCGGCCAGATGATGACCTAGATATTCTCGAGAATATCTAGGTCATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018740.1-1221s1c1
Sequence:CCGGCCTTGTCCTTTGTTACTTTGTCTCGAGACAAAGTAACAAAGGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018740.1-1215s1c1
Sequence:CCGGCTTGTCCCTTGTCCTTTGTTACTCGAGTAACAAAGGACAAGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018740.1-336s1c1
Sequence:CCGGCTTATCAAGAAATCTGCACTTCTCGAGAAGTGCAGATTTCTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks