EMAIL THIS PAGE TO A FRIEND

ELP6

elongator acetyltransferase complex subunit 6

102 Gene Product Result for
Synonyms: C3orf75 TMEM103
UniProtKB ID: Q0PNE2, Q9BW57, Q9NXJ3
Gene ID:
Mouse(72341) elongator acetyltransferase complex subunit 6
Rat(363150) elongator acetyltransferase complex subunit 6
Zebrafish(751679) elongator acetyltransferase complex subunit 6
Thale Cress(826600) elongator protein 6
domestic cat(101086045) elongator acetyltransferase complex subunit 6
dog(609199) elongator acetyltransferase complex subunit 6
domestic guinea pig(100724322) elongator acetyltransferase complex subunit 6
naked mole-rat(101707387) elongator acetyltransferase complex subunit 6
sheep(101113703) elongator acetyltransferase complex subunit 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001031703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031703 Rosetta Predictions human pricing
NM_001108782 Rosetta Predictions rat pricing
NM_001081381 Rosetta Predictions mouse pricing
XM_135177 Rosetta Predictions mouse pricing
XM_895137 Rosetta Predictions mouse pricing
XM_902998 Rosetta Predictions mouse pricing
XM_915086 Rosetta Predictions mouse pricing
XM_923582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200567 predicted 209
2 SASI_Hs02_00307718 predicted 840
3 SASI_Hs02_00307719 predicted 533
4 SASI_Hs01_00200569 predicted 443
5 SASI_Hs01_00200570 predicted 444
6 SASI_Hs01_00200571 predicted 432
7 SASI_Hs01_00200572 predicted 457
8 SASI_Hs01_00200573 predicted 382
9 SASI_Hs01_00200574 predicted 854
10 SASI_Hs01_00200575 predicted 585
11 SASI_Hs01_00200568 predicted 204
12 SASI_Hs01_00200576 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242025 predicted 741
2 SASI_Rn02_00242026 predicted 811
3 SASI_Rn02_00242027 predicted 744
4 SASI_Rn02_00242028 predicted 731
5 SASI_Rn02_00242029 predicted 586
6 SASI_Rn02_00242030 predicted 877
7 SASI_Rn02_00242031 predicted 834
8 SASI_Rn02_00242032 predicted 436
9 SASI_Rn02_00242033 predicted 573
10 SASI_Rn02_00242034 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297851 predicted 819
2 SASI_Mm02_00297852 predicted 816
3 SASI_Mm02_00297853 predicted 1163
4 SASI_Mm02_00297854 predicted 460
5 SASI_Mm02_00297855 predicted 924
6 SASI_Mm02_00297856 predicted 904
7 SASI_Mm02_00297857 predicted 577
8 SASI_Mm02_00297858 predicted 922
9 SASI_Mm02_00297859 predicted 946
10 SASI_Mm02_00297860 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424608 predicted 972
2 SASI_Mm01_00264720 predicted 979
3 SASI_Mm01_00264722 predicted 1053
4 SASI_Mm01_00264723 predicted 614
5 SASI_Mm01_00264724 predicted 1077
6 SASI_Mm01_00264725 predicted 1057
7 SASI_Mm01_00264727 predicted 730
8 SASI_Mm02_00424609 predicted 1210
9 SASI_Mm01_00264728 predicted 726
10 SASI_Mm01_00264729 predicted 1068
11 SASI_Mm01_00264721 predicted 614
12 SASI_Mm01_00264726 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258885 predicted 845
2 SASI_Mm01_00258886 predicted 913
3 SASI_Mm02_00429654 predicted 477
4 SASI_Mm01_00258888 predicted 938
5 SASI_Mm01_00258889 predicted 921
6 SASI_Mm01_00258891 predicted 601
7 SASI_Mm02_00429655 predicted 1072
8 SASI_Mm01_00258892 predicted 587
9 SASI_Mm01_00258893 predicted 934
10 SASI_Mm01_00258894 predicted 967
11 SASI_Mm01_00258887 predicted 250
12 SASI_Mm01_00258890 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239604 predicted 840
2 SASI_Mm01_00239605 predicted 471
3 SASI_Mm01_00239606 predicted 919
4 SASI_Mm01_00239607 predicted 482
5 SASI_Mm01_00239608 predicted 948
6 SASI_Mm01_00239609 predicted 922
7 SASI_Mm01_00239610 predicted 939
8 SASI_Mm01_00239611 predicted 598
9 SASI_Mm01_00239612 predicted 598
10 SASI_Mm01_00239613 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439135 predicted 836
2 SASI_Mm02_00439136 predicted 1191
3 SASI_Mm02_00439137 predicted 473
4 SASI_Mm02_00439138 predicted 945
5 SASI_Mm02_00439139 predicted 921
6 SASI_Mm02_00439140 predicted 596
7 SASI_Mm02_00439141 predicted 932
8 SASI_Mm02_00439142 predicted 968
9 SASI_Mm02_00439143 predicted 853
10 SASI_Mm02_00439144 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443889 predicted 974
2 SASI_Mm02_00443890 predicted 978
3 SASI_Mm02_00443891 predicted 614
4 SASI_Mm02_00443892 predicted 1073
5 SASI_Mm02_00443893 predicted 1055
6 SASI_Mm02_00443894 predicted 737
7 SASI_Mm02_00443895 predicted 1077
8 SASI_Mm02_00443896 predicted 1109
9 SASI_Mm02_00443897 predicted 980
10 SASI_Mm02_00443898 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017713
ELP6 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000130946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-704s1c1
Sequence:CCGGCAGTCATCAGAGCCATCTGATCTCGAGATCAGATGGCTCTGATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-161s1c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-215s1c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017713.1-1049s1c1
Sequence:CCGGCATGCCATCAAATAACAGCAACTCGAGTTGCTGTTATTTGATGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017713
ELP6 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000130946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-704s1c1
Sequence:CCGGCAGTCATCAGAGCCATCTGATCTCGAGATCAGATGGCTCTGATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-161s1c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-215s1c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017713.1-1049s1c1
Sequence:CCGGCATGCCATCAAATAACAGCAACTCGAGTTGCTGTTATTTGATGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017713
ELP6 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000130946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-704s1c1
Sequence:CCGGCAGTCATCAGAGCCATCTGATCTCGAGATCAGATGGCTCTGATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-161s1c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017713.1-215s1c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017713.1-1049s1c1
Sequence:CCGGCATGCCATCAAATAACAGCAACTCGAGTTGCTGTTATTTGATGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031703
ELP6 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-230s21c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-623s21c1
Sequence:CCGGCACCGTGTGCTGGGAACTAAACTCGAGTTTAGTTCCCAGCACACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-176s21c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031703.2-997s21c1
Sequence:CCGGCTTTCTCCTCTGTAGTAATATCTCGAGATATTACTACAGAGGAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-841s21c1
Sequence:CCGGAGAGCTTCACTTACCAGTATACTCGAGTATACTGGTAAGTGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031703
ELP6 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-230s21c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-623s21c1
Sequence:CCGGCACCGTGTGCTGGGAACTAAACTCGAGTTTAGTTCCCAGCACACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-176s21c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031703.2-997s21c1
Sequence:CCGGCTTTCTCCTCTGTAGTAATATCTCGAGATATTACTACAGAGGAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-841s21c1
Sequence:CCGGAGAGCTTCACTTACCAGTATACTCGAGTATACTGGTAAGTGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031703
ELP6 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-230s21c1
Sequence:CCGGCTTTCTCTCCTTCTATCTCAACTCGAGTTGAGATAGAAGGAGAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-623s21c1
Sequence:CCGGCACCGTGTGCTGGGAACTAAACTCGAGTTTAGTTCCCAGCACACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-176s21c1
Sequence:CCGGGAAACTGACTCTACTCTGTGACTCGAGTCACAGAGTAGAGTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031703.2-997s21c1
Sequence:CCGGCTTTCTCCTCTGTAGTAATATCTCGAGATATTACTACAGAGGAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031703.2-841s21c1
Sequence:CCGGAGAGCTTCACTTACCAGTATACTCGAGTATACTGGTAAGTGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081381
VALIDATED
ELP6 MISSION shRNA Bacterial Glycerol Stock
elongator acetyltransferase complex subunit 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-450s21c1
Sequence:CCGGCAGTCACTGTATACGTTTATTCTCGAGAATAAACGTATACAGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-266s21c1
Sequence:CCGGTGTCCAGTCCTTCAGCCATTACTCGAGTAATGGCTGAAGGACTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081381.1-1658s21c1
Sequence:CCGGAGTTACTGTAATGCATCTTTGCTCGAGCAAAGATGCATTACAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-224s21c1
Sequence:CCGGCTTCTACCTGAAAGCTAATTGCTCGAGCAATTAGCTTTCAGGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081381.1-893s21c1
Sequence:CCGGTGCTGTTCTGTGACCTGATTTCTCGAGAAATCAGGTCACAGAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081381
VALIDATED
ELP6 MISSION shRNA shRNA Plasmid DNA
elongator acetyltransferase complex subunit 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-450s21c1
Sequence:CCGGCAGTCACTGTATACGTTTATTCTCGAGAATAAACGTATACAGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-266s21c1
Sequence:CCGGTGTCCAGTCCTTCAGCCATTACTCGAGTAATGGCTGAAGGACTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081381.1-1658s21c1
Sequence:CCGGAGTTACTGTAATGCATCTTTGCTCGAGCAAAGATGCATTACAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-224s21c1
Sequence:CCGGCTTCTACCTGAAAGCTAATTGCTCGAGCAATTAGCTTTCAGGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081381.1-893s21c1
Sequence:CCGGTGCTGTTCTGTGACCTGATTTCTCGAGAAATCAGGTCACAGAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081381
VALIDATED
ELP6 MISSION shRNA Lentiviral Transduction Particles
elongator acetyltransferase complex subunit 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-450s21c1
Sequence:CCGGCAGTCACTGTATACGTTTATTCTCGAGAATAAACGTATACAGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-266s21c1
Sequence:CCGGTGTCCAGTCCTTCAGCCATTACTCGAGTAATGGCTGAAGGACTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081381.1-1658s21c1
Sequence:CCGGAGTTACTGTAATGCATCTTTGCTCGAGCAAAGATGCATTACAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081381.1-224s21c1
Sequence:CCGGCTTCTACCTGAAAGCTAATTGCTCGAGCAATTAGCTTTCAGGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081381.1-893s21c1
Sequence:CCGGTGCTGTTCTGTGACCTGATTTCTCGAGAAATCAGGTCACAGAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)