EMAIL THIS PAGE TO A FRIEND

ELSPBP1

epididymal sperm binding protein 1

20 Gene Product Result for
Synonyms: E12 EDDM12 HE12
UniProtKB ID: Q96BH3, Q96RT0, Q9H4C8
Gene ID:
Human(64100) Summary: The protein encoded by this gene belongs to the sperm-coating protein family of epididymal origin. This protein and its canine homolog are the first known examples of proteins with four tandemly arranged fibronectin type 2 (Fn2) domains in the Fn2-module protein family. [provided by RefSeq, Jul 2008]
sheep(101120351) epididymal sperm binding protein 1
naked mole-rat(101713801) epididymal sperm binding protein 1
domestic guinea pig(100730399) epididymal sperm binding protein 1
cow(522297) epididymal sperm binding protein 1
domestic cat(101087953) epididymal sperm binding protein 1
dog(399530) epididymal sperm binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022142 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189718 predicted 765
2 SASI_Hs01_00189719 predicted 369
3 SASI_Hs01_00189720 predicted 483
4 SASI_Hs01_00189721 predicted 335
5 SASI_Hs01_00189722 predicted 614
6 SASI_Hs01_00189723 predicted 488
7 SASI_Hs01_00189724 predicted 694
8 SASI_Hs01_00189725 predicted 568
9 SASI_Hs01_00189726 predicted 618
10 SASI_Hs01_00189727 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022142
ELSPBP1 MISSION shRNA Bacterial Glycerol Stock
epididymal sperm binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-741s21c1
Sequence:CCGGTGCACTAACAAAGGATCAAAGCTCGAGCTTTGATCCTTTGTTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-393s21c1
Sequence:CCGGTATCGAGGAAAGGCTTATAACCTCGAGGTTATAAGCCTTTCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-254s21c1
Sequence:CCGGCACCTACAAGGGATCTGTTTACTCGAGTAAACAGATCCCTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-360s21c1
Sequence:CCGGGAAGATTACCCACGCTGTATCCTCGAGGATACAGCGTGGGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-691s1c1
Sequence:CCGGGCTTTCCTTGTCACTTTCCGTCTCGAGACGGAAAGTGACAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-776s1c1
Sequence:CCGGGTGTGCAACTTCTTACAACTACTCGAGTAGTTGTAAGAAGTTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-283s1c1
Sequence:CCGGGCACCCATATTCATAGCTTATCTCGAGATAAGCTATGAATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-626s1c1
Sequence:CCGGGAACATGGATAAGGATGGAAACTCGAGTTTCCATCCTTATCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022142
ELSPBP1 MISSION shRNA shRNA Plasmid DNA
epididymal sperm binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-741s21c1
Sequence:CCGGTGCACTAACAAAGGATCAAAGCTCGAGCTTTGATCCTTTGTTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-393s21c1
Sequence:CCGGTATCGAGGAAAGGCTTATAACCTCGAGGTTATAAGCCTTTCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-254s21c1
Sequence:CCGGCACCTACAAGGGATCTGTTTACTCGAGTAAACAGATCCCTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-360s21c1
Sequence:CCGGGAAGATTACCCACGCTGTATCCTCGAGGATACAGCGTGGGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-691s1c1
Sequence:CCGGGCTTTCCTTGTCACTTTCCGTCTCGAGACGGAAAGTGACAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-776s1c1
Sequence:CCGGGTGTGCAACTTCTTACAACTACTCGAGTAGTTGTAAGAAGTTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-283s1c1
Sequence:CCGGGCACCCATATTCATAGCTTATCTCGAGATAAGCTATGAATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-626s1c1
Sequence:CCGGGAACATGGATAAGGATGGAAACTCGAGTTTCCATCCTTATCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022142
ELSPBP1 MISSION shRNA Lentiviral Transduction Particles
epididymal sperm binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-741s21c1
Sequence:CCGGTGCACTAACAAAGGATCAAAGCTCGAGCTTTGATCCTTTGTTAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-393s21c1
Sequence:CCGGTATCGAGGAAAGGCTTATAACCTCGAGGTTATAAGCCTTTCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-254s21c1
Sequence:CCGGCACCTACAAGGGATCTGTTTACTCGAGTAAACAGATCCCTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022142.3-360s21c1
Sequence:CCGGGAAGATTACCCACGCTGTATCCTCGAGGATACAGCGTGGGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-691s1c1
Sequence:CCGGGCTTTCCTTGTCACTTTCCGTCTCGAGACGGAAAGTGACAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-776s1c1
Sequence:CCGGGTGTGCAACTTCTTACAACTACTCGAGTAGTTGTAAGAAGTTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-283s1c1
Sequence:CCGGGCACCCATATTCATAGCTTATCTCGAGATAAGCTATGAATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022142.3-626s1c1
Sequence:CCGGGAACATGGATAAGGATGGAAACTCGAGTTTCCATCCTTATCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks