EMAIL THIS PAGE TO A FRIEND

ELTD1

EGF, latrophilin and seven transmembrane domain containing 1

104 Gene Product Result for
Synonyms: ETL KPG_003
UniProtKB ID: Q9HBW9, B1AR71, Q5KU34
Gene ID:
Mouse(170757) EGF, latrophilin seven transmembrane domain containing 1
Rat(64124) EGF, latrophilin and seven transmembrane domain containing 1
Zebrafish(406676) EGF, latrophilin and seven transmembrane domain containing 1
cow(535066) EGF, latrophilin and seven transmembrane domain containing 1
Horse(100052983) EGF, latrophilin and seven transmembrane domain containing 1
domestic cat(101093625) EGF, latrophilin and seven transmembrane domain containing 1
chicken(424546) EGF, latrophilin and seven transmembrane domain containing 1
domestic guinea pig(100713516) EGF, latrophilin and seven transmembrane domain containing 1
naked mole-rat(101696826) EGF, latrophilin and seven transmembrane domain containing 1
sheep(101103604) EGF, latrophilin and seven transmembrane domain containing 1
Domestic Rabbit(100343987) EGF, latrophilin and seven transmembrane domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022159 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011661 MISSION® esiRNA esiRNA targeting human ELTD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022159 Rosetta Predictions human pricing
XM_371262 Rosetta Predictions human pricing
NM_022294 Rosetta Predictions rat pricing
NM_133222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355581 predicted 779
2 SASI_Hs02_00355582 predicted 1237
3 SASI_Hs02_00355583 predicted 1176
4 SASI_Hs02_00355584 predicted 892
5 SASI_Hs02_00355585 predicted 1359
6 SASI_Hs02_00355586 predicted 2168
7 SASI_Hs02_00355587 predicted 1464
8 SASI_Hs02_00355588 predicted 267
9 SASI_Hs02_00355589 predicted 385
10 SASI_Hs02_00355590 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286105 predicted 1685
2 SASI_Hs01_00286106 predicted 974
3 SASI_Hs01_00286107 predicted 1055
4 SASI_Hs01_00286108 predicted 883
5 SASI_Hs01_00286109 predicted 878
6 SASI_Hs01_00286110 predicted 1591
7 SASI_Hs01_00286111 predicted 1591
8 SASI_Hs01_00286112 predicted 845
9 SASI_Hs01_00286113 predicted 1626
10 SASI_Hs01_00286114 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115664 predicted 1986
2 SASI_Rn01_00115665 predicted 1109
3 SASI_Rn01_00115666 predicted 1434
4 SASI_Rn01_00115667 predicted 1011
5 SASI_Rn01_00115668 predicted 1964
6 SASI_Rn01_00115669 predicted 800
7 SASI_Rn02_00263111 predicted 1266
8 SASI_Rn01_00115670 predicted 2389
9 SASI_Rn01_00115671 predicted 2487
10 SASI_Rn01_00115672 predicted 2029
11 SASI_Rn01_00115673 predicted 2464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143585 predicted 1133
2 SASI_Mm01_00143587 predicted 253
3 SASI_Mm01_00143586 predicted 2409
4 SASI_Mm02_00338453 predicted 842
5 SASI_Mm01_00143588 predicted 402
6 SASI_Mm01_00143589 predicted 2256
7 SASI_Mm01_00143590 predicted 1682
8 SASI_Mm01_00143591 predicted 804
9 SASI_Mm02_00338454 predicted 1260
10 SASI_Mm01_00143593 predicted 1769
11 SASI_Mm01_00143584 predicted 978
12 SASI_Mm01_00143592 predicted 2018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371262
ELTD1 MISSION shRNA Bacterial Glycerol Stock
EGF, latrophilin and seven transmembrane domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-2011s1c1
Sequence:CCGGGCACTAGGATACAGATATTATCTCGAGATAATATCTGTATCCTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1567s1c1
Sequence:CCGGCGCTGTAATCACCTGACACATCTCGAGATGTGTCAGGTGATTACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-917s1c1
Sequence:CCGGCCCTTTCTAACTCAACTCTTACTCGAGTAAGAGTTGAGTTAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1396s1c1
Sequence:CCGGCCCACATTATATGAACTTGAACTCGAGTTCAAGTTCATATAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-707s1c1
Sequence:CCGGGCCATTTAGATAATGTCTGTACTCGAGTACAGACATTATCTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371262
ELTD1 MISSION shRNA shRNA Plasmid DNA
EGF, latrophilin and seven transmembrane domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-2011s1c1
Sequence:CCGGGCACTAGGATACAGATATTATCTCGAGATAATATCTGTATCCTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1567s1c1
Sequence:CCGGCGCTGTAATCACCTGACACATCTCGAGATGTGTCAGGTGATTACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-917s1c1
Sequence:CCGGCCCTTTCTAACTCAACTCTTACTCGAGTAAGAGTTGAGTTAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1396s1c1
Sequence:CCGGCCCACATTATATGAACTTGAACTCGAGTTCAAGTTCATATAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-707s1c1
Sequence:CCGGGCCATTTAGATAATGTCTGTACTCGAGTACAGACATTATCTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371262
ELTD1 MISSION shRNA Lentiviral Transduction Particles
EGF, latrophilin and seven transmembrane domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-2011s1c1
Sequence:CCGGGCACTAGGATACAGATATTATCTCGAGATAATATCTGTATCCTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1567s1c1
Sequence:CCGGCGCTGTAATCACCTGACACATCTCGAGATGTGTCAGGTGATTACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-917s1c1
Sequence:CCGGCCCTTTCTAACTCAACTCTTACTCGAGTAAGAGTTGAGTTAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-1396s1c1
Sequence:CCGGCCCACATTATATGAACTTGAACTCGAGTTCAAGTTCATATAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371262.1-707s1c1
Sequence:CCGGGCCATTTAGATAATGTCTGTACTCGAGTACAGACATTATCTAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133222
ELTD1 MISSION shRNA Bacterial Glycerol Stock
EGF, latrophilin and seven transmembrane domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1980s1c1
Sequence:CCGGCCAGCGTGTCTAATCATTCTTCTCGAGAAGAATGATTAGACACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-310s1c1
Sequence:CCGGGCGATCATGCTGTGTGTGAAACTCGAGTTTCACACACAGCATGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-804s1c1
Sequence:CCGGGCCCACTTCAACTCAACTCTTCTCGAGAAGAGTTGAGTTGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1504s1c1
Sequence:CCGGCCATTGGGATTAAGGATTATACTCGAGTATAATCCTTAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1550s1c1
Sequence:CCGGCGGGATAATCATCTCCCTGATCTCGAGATCAGGGAGATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133222
ELTD1 MISSION shRNA shRNA Plasmid DNA
EGF, latrophilin and seven transmembrane domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1980s1c1
Sequence:CCGGCCAGCGTGTCTAATCATTCTTCTCGAGAAGAATGATTAGACACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-310s1c1
Sequence:CCGGGCGATCATGCTGTGTGTGAAACTCGAGTTTCACACACAGCATGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-804s1c1
Sequence:CCGGGCCCACTTCAACTCAACTCTTCTCGAGAAGAGTTGAGTTGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1504s1c1
Sequence:CCGGCCATTGGGATTAAGGATTATACTCGAGTATAATCCTTAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1550s1c1
Sequence:CCGGCGGGATAATCATCTCCCTGATCTCGAGATCAGGGAGATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133222
ELTD1 MISSION shRNA Lentiviral Transduction Particles
EGF, latrophilin and seven transmembrane domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1980s1c1
Sequence:CCGGCCAGCGTGTCTAATCATTCTTCTCGAGAAGAATGATTAGACACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-310s1c1
Sequence:CCGGGCGATCATGCTGTGTGTGAAACTCGAGTTTCACACACAGCATGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-804s1c1
Sequence:CCGGGCCCACTTCAACTCAACTCTTCTCGAGAAGAGTTGAGTTGAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1504s1c1
Sequence:CCGGCCATTGGGATTAAGGATTATACTCGAGTATAATCCTTAATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133222.1-1550s1c1
Sequence:CCGGCGGGATAATCATCTCCCTGATCTCGAGATCAGGGAGATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022159
ELTD1 MISSION shRNA Bacterial Glycerol Stock
EGF, latrophilin and seven transmembrane domain containing 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000356975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1401s21c1
Sequence:CCGGTGGTCCTTCCATTGGTATTAACTCGAGTTAATACCAATGGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1550s21c1
Sequence:CCGGATCTTTGCTGTAGCCTATTTCCTCGAGGAAATAGGCTACAGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1348s21c1
Sequence:CCGGCACACCTCATGCCGCTGTAATCTCGAGATTACAGCGGCATGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022159
ELTD1 MISSION shRNA shRNA Plasmid DNA
EGF, latrophilin and seven transmembrane domain containing 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000356975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1401s21c1
Sequence:CCGGTGGTCCTTCCATTGGTATTAACTCGAGTTAATACCAATGGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1550s21c1
Sequence:CCGGATCTTTGCTGTAGCCTATTTCCTCGAGGAAATAGGCTACAGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1348s21c1
Sequence:CCGGCACACCTCATGCCGCTGTAATCTCGAGATTACAGCGGCATGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022159
ELTD1 MISSION shRNA Lentiviral Transduction Particles
EGF, latrophilin and seven transmembrane domain containing 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000356975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1401s21c1
Sequence:CCGGTGGTCCTTCCATTGGTATTAACTCGAGTTAATACCAATGGAAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1550s21c1
Sequence:CCGGATCTTTGCTGTAGCCTATTTCCTCGAGGAAATAGGCTACAGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022159.3-1348s21c1
Sequence:CCGGCACACCTCATGCCGCTGTAATCTCGAGATTACAGCGGCATGAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks