EMAIL THIS PAGE TO A FRIEND

EMB

embigin

75 Gene Product Result for
UniProtKB ID: Q6PCB8, B7Z6S3
Gene ID:
Human(133418) Summary: This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Jan 2009]
Mouse(13723) embigin
Rat(114511) embigin
fruit fly(34167) embargoed
chicken(395242) embigin homolog (mouse)
cow(785366) embigin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198449 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198449 Rosetta Predictions human pricing
NM_053719 Rosetta Predictions rat pricing
NM_010330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371957 predicted 937
2 SASI_Hs01_00199340 predicted 1131
3 SASI_Hs01_00199341 predicted 616
4 SASI_Hs01_00199342 predicted 1008
5 SASI_Hs01_00199343 predicted 1222
6 SASI_Hs01_00199344 predicted 581
7 SASI_Hs01_00199345 predicted 504
8 SASI_Hs01_00199346 predicted 533
9 SASI_Hs01_00199347 predicted 798
10 SASI_Hs01_00199348 predicted 879
11 SASI_Hs01_00199349 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115772 predicted 244
2 SASI_Rn01_00115773 predicted 329
3 SASI_Rn01_00115774 predicted 376
4 SASI_Rn02_00266483 predicted 1005
5 SASI_Rn01_00115776 predicted 881
6 SASI_Rn01_00115777 predicted 424
7 SASI_Rn01_00115778 predicted 461
8 SASI_Rn02_00266484 predicted 701
9 SASI_Rn01_00115779 predicted 1113
10 SASI_Rn01_00115780 predicted 912
11 SASI_Rn01_00115775 predicted 611
12 SASI_Rn01_00115781 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097085 predicted 1309
2 SASI_Mm01_00097086 predicted 1143
3 SASI_Mm01_00097087 predicted 1247
4 SASI_Mm01_00097088 predicted 1319
5 SASI_Mm01_00097089 predicted 1344
6 SASI_Mm01_00097090 predicted 1505
7 SASI_Mm01_00097091 predicted 427
8 SASI_Mm01_00097092 predicted 397
9 SASI_Mm01_00097093 predicted 378
10 SASI_Mm01_00097094 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010330
EMB MISSION shRNA Bacterial Glycerol Stock
embigin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010330.2-1313s1c1
Sequence:CCGGGCACAGAAGTAGCTTTATGAACTCGAGTTCATAAAGCTACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-559s1c1
Sequence:CCGGCGGGTGACTTCAATACAACTACTCGAGTAGTTGTATTGAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-875s1c1
Sequence:CCGGTGCCAATGAAACAAGGCTCAACTCGAGTTGAGCCTTGTTTCATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-354s1c1
Sequence:CCGGCGAGAAGAAATGATGGCGAAACTCGAGTTTCGCCATCATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-1053s1c1
Sequence:CCGGGCCATCATTCTGCTTTGTGAACTCGAGTTCACAAAGCAGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010330
EMB MISSION shRNA shRNA Plasmid DNA
embigin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010330.2-1313s1c1
Sequence:CCGGGCACAGAAGTAGCTTTATGAACTCGAGTTCATAAAGCTACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-559s1c1
Sequence:CCGGCGGGTGACTTCAATACAACTACTCGAGTAGTTGTATTGAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-875s1c1
Sequence:CCGGTGCCAATGAAACAAGGCTCAACTCGAGTTGAGCCTTGTTTCATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-354s1c1
Sequence:CCGGCGAGAAGAAATGATGGCGAAACTCGAGTTTCGCCATCATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-1053s1c1
Sequence:CCGGGCCATCATTCTGCTTTGTGAACTCGAGTTCACAAAGCAGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010330
EMB MISSION shRNA Lentiviral Transduction Particles
embigin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010330.2-1313s1c1
Sequence:CCGGGCACAGAAGTAGCTTTATGAACTCGAGTTCATAAAGCTACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-559s1c1
Sequence:CCGGCGGGTGACTTCAATACAACTACTCGAGTAGTTGTATTGAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-875s1c1
Sequence:CCGGTGCCAATGAAACAAGGCTCAACTCGAGTTGAGCCTTGTTTCATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-354s1c1
Sequence:CCGGCGAGAAGAAATGATGGCGAAACTCGAGTTTCGCCATCATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010330.2-1053s1c1
Sequence:CCGGGCCATCATTCTGCTTTGTGAACTCGAGTTCACAAAGCAGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198449
EMB MISSION shRNA Bacterial Glycerol Stock
embigin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1269s1c1
Sequence:CCGGCCTGTTAAGAGCCTCTGAGTTCTCGAGAACTCAGAGGCTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1254s1c1
Sequence:CCGGGCTTTGTTTATCCTTCCTGTTCTCGAGAACAGGAAGGATAAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-820s1c1
Sequence:CCGGCCTGTTGGTGTTCAAATGAATCTCGAGATTCATTTGAACACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-568s1c1
Sequence:CCGGGCAACAGGAAGCACCTTGTATCTCGAGATACAAGGTGCTTCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1562s1c1
Sequence:CCGGCCTTTGCCATTTGTCTTAGAACTCGAGTTCTAAGACAAATGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-508s1c1
Sequence:CCGGGCAGTAAATGTGACTTGGAAACTCGAGTTTCCAAGTCACATTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-412s1c1
Sequence:CCGGGAACATTCTAGTATGCCAGTACTCGAGTACTGGCATACTAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-1125s1c1
Sequence:CCGGGCTGAAATCAGATGATAGCAACTCGAGTTGCTATCATCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-404s1c1
Sequence:CCGGCACTGACTGAACATTCTAGTACTCGAGTACTAGAATGTTCAGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198449
EMB MISSION shRNA shRNA Plasmid DNA
embigin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1269s1c1
Sequence:CCGGCCTGTTAAGAGCCTCTGAGTTCTCGAGAACTCAGAGGCTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1254s1c1
Sequence:CCGGGCTTTGTTTATCCTTCCTGTTCTCGAGAACAGGAAGGATAAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-820s1c1
Sequence:CCGGCCTGTTGGTGTTCAAATGAATCTCGAGATTCATTTGAACACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-568s1c1
Sequence:CCGGGCAACAGGAAGCACCTTGTATCTCGAGATACAAGGTGCTTCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1562s1c1
Sequence:CCGGCCTTTGCCATTTGTCTTAGAACTCGAGTTCTAAGACAAATGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-508s1c1
Sequence:CCGGGCAGTAAATGTGACTTGGAAACTCGAGTTTCCAAGTCACATTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-412s1c1
Sequence:CCGGGAACATTCTAGTATGCCAGTACTCGAGTACTGGCATACTAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-1125s1c1
Sequence:CCGGGCTGAAATCAGATGATAGCAACTCGAGTTGCTATCATCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-404s1c1
Sequence:CCGGCACTGACTGAACATTCTAGTACTCGAGTACTAGAATGTTCAGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198449
EMB MISSION shRNA Lentiviral Transduction Particles
embigin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1269s1c1
Sequence:CCGGCCTGTTAAGAGCCTCTGAGTTCTCGAGAACTCAGAGGCTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1254s1c1
Sequence:CCGGGCTTTGTTTATCCTTCCTGTTCTCGAGAACAGGAAGGATAAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-820s1c1
Sequence:CCGGCCTGTTGGTGTTCAAATGAATCTCGAGATTCATTTGAACACCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-568s1c1
Sequence:CCGGGCAACAGGAAGCACCTTGTATCTCGAGATACAAGGTGCTTCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198449.1-1562s1c1
Sequence:CCGGCCTTTGCCATTTGTCTTAGAACTCGAGTTCTAAGACAAATGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-508s1c1
Sequence:CCGGGCAGTAAATGTGACTTGGAAACTCGAGTTTCCAAGTCACATTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-412s1c1
Sequence:CCGGGAACATTCTAGTATGCCAGTACTCGAGTACTGGCATACTAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198449.1-1125s1c1
Sequence:CCGGGCTGAAATCAGATGATAGCAACTCGAGTTGCTATCATCTGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198449.1-404s1c1
Sequence:CCGGCACTGACTGAACATTCTAGTACTCGAGTACTAGAATGTTCAGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks