EMAIL THIS PAGE TO A FRIEND

EMC10

ER membrane protein complex subunit 10

56 Gene Product Result for
Synonyms: C19orf63 HSM1 HSS1 INM02
UniProtKB ID: Q5UCC4, Q5UCC6, Q69YT5, Q6UWP3, Q86YL4, Q8N541
Gene ID:
Mouse(69683) ER membrane protein complex subunit 10
Rat(292878) ER membrane protein complex subunit 10
naked mole-rat(101696362) ER membrane protein complex subunit 10
domestic guinea pig(100718927) ER membrane protein complex subunit 10
sheep(101117529) ER membrane protein complex subunit 10
Zebrafish(565829) ER membrane protein complex subunit 10
dog(484362) ER membrane protein complex subunit 10
domestic cat(101085509) ER membrane protein complex subunit 10
cow(507692) chromosome 18 open reading frame, human C19orf63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048591 MISSION® esiRNA esiRNA targeting mouse 2310044H10Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175063 Rosetta Predictions human pricing
NM_206538 Rosetta Predictions human pricing
NM_001004221 Rosetta Predictions rat pricing
NM_197991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126868 predicted 432
2 SASI_Hs01_00126869 predicted 1212
3 SASI_Hs01_00126870 predicted 1226
4 SASI_Hs01_00126871 predicted 235
5 SASI_Hs01_00126872 predicted 302
6 SASI_Hs01_00126873 predicted 421
7 SASI_Hs02_00368967 predicted 816
8 SASI_Hs01_00126874 predicted 821
9 SASI_Hs01_00126875 predicted 712
10 SASI_Hs01_00126876 predicted 824
11 SASI_Hs01_00126877 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224708 predicted 433
2 SASI_Hs01_00224709 predicted 1124
3 SASI_Hs01_00224710 predicted 1137
4 SASI_Hs01_00224711 predicted 229
5 SASI_Hs01_00224712 predicted 298
6 SASI_Hs01_00224713 predicted 422
7 SASI_Hs01_00224714 predicted 735
8 SASI_Hs01_00224715 predicted 717
9 SASI_Hs01_00224716 predicted 718
10 SASI_Hs01_00224717 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073216 predicted 734
2 SASI_Rn01_00073217 predicted 239
3 SASI_Rn01_00073218 predicted 1093
4 SASI_Rn01_00073219 predicted 1008
5 SASI_Rn01_00073220 predicted 488
6 SASI_Rn02_00198213 predicted 919
7 SASI_Rn01_00073221 predicted 760
8 SASI_Rn01_00073222 predicted 532
9 SASI_Rn01_00073223 predicted 744
10 SASI_Rn02_00198214 predicted 411
11 SASI_Rn01_00073224 predicted 741
12 SASI_Rn01_00073225 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148955 predicted 384
2 SASI_Mm01_00148956 predicted 226
3 SASI_Mm01_00148957 predicted 1230
4 SASI_Mm01_00148958 predicted 1184
5 SASI_Mm01_00148959 predicted 1055
6 SASI_Mm01_00148960 predicted 492
7 SASI_Mm01_00148961 predicted 405
8 SASI_Mm01_00148962 predicted 272
9 SASI_Mm01_00148963 predicted 285
10 SASI_Mm02_00350684 predicted 725
11 SASI_Mm01_00148964 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175063
VALIDATED
EMC10 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 10
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-834s21c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-723s21c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1390s21c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1916s21c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2532s1c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1450s1c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175063.3-2289s1c1
Sequence:CCGGGCCCAGACACTGTAAATAGAACTCGAGTTCTATTTACAGTGTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2268s1c1
Sequence:CCGGCCAACAGTTAGTGGAGTCAAACTCGAGTTTGACTCCACTAACTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2006s1c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1339s1c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-1337s1c1
Sequence:CCGGCAGAAGTCCTTCTTCGCCAAACTCGAGTTTGGCGAAGAAGGACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-866s1c1
Sequence:CCGGGATCGATGACAGTGCCAACTTCTCGAGAAGTTGGCACTGTCATCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175063
VALIDATED
EMC10 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 10
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-834s21c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-723s21c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1390s21c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1916s21c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2532s1c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1450s1c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175063.3-2289s1c1
Sequence:CCGGGCCCAGACACTGTAAATAGAACTCGAGTTCTATTTACAGTGTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2268s1c1
Sequence:CCGGCCAACAGTTAGTGGAGTCAAACTCGAGTTTGACTCCACTAACTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2006s1c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1339s1c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-1337s1c1
Sequence:CCGGCAGAAGTCCTTCTTCGCCAAACTCGAGTTTGGCGAAGAAGGACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-866s1c1
Sequence:CCGGGATCGATGACAGTGCCAACTTCTCGAGAAGTTGGCACTGTCATCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175063
VALIDATED
EMC10 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 10
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-834s21c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-723s21c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1390s21c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_175063.4-1916s21c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2532s1c1
Sequence:CCGGGCTCACTTGATACGTTATTCACTCGAGTGAATAACGTATCAAGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1450s1c1
Sequence:CCGGGATGTACATCATTCCCGTCGTCTCGAGACGACGGGAATGATGTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175063.3-2289s1c1
Sequence:CCGGGCCCAGACACTGTAAATAGAACTCGAGTTCTATTTACAGTGTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2268s1c1
Sequence:CCGGCCAACAGTTAGTGGAGTCAAACTCGAGTTTGACTCCACTAACTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-2006s1c1
Sequence:CCGGCCTCACTTTGACACTGGACTACTCGAGTAGTCCAGTGTCAAAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_175063.3-1339s1c1
Sequence:CCGGGAAGTCCTTCTTCGCCAAATACTCGAGTATTTGGCGAAGAAGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-1337s1c1
Sequence:CCGGCAGAAGTCCTTCTTCGCCAAACTCGAGTTTGGCGAAGAAGGACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175063.3-866s1c1
Sequence:CCGGGATCGATGACAGTGCCAACTTCTCGAGAAGTTGGCACTGTCATCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197991
EMC10 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197991.1-1321s21c1
Sequence:CCGGCCATGGTGACCTATCACTATCCTCGAGGATAGTGATAGGTCACCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-685s21c1
Sequence:CCGGCCACAGGAGCAGAAGTCTTTCCTCGAGGAAAGACTTCTGCTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-639s21c1
Sequence:CCGGCTTCATTGAGCGCCTGGAAATCTCGAGATTTCCAGGCGCTCAATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-566s21c1
Sequence:CCGGAGGACCTGGAGCTGTTCAATACTCGAGTATTGAACAGCTCCAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-199s21c1
Sequence:CCGGTTGCTGCTGGAGCATTCATTTCTCGAGAAATGAATGCTCCAGCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-711s1c1
Sequence:CCGGCAAATACTGGATGTACATCATCTCGAGATGATGTACATCCAGTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-694s1c1
Sequence:CCGGCAGAAGTCTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAAGACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-696s1c1
Sequence:CCGGGAAGTCTTTCTTTGCCAAATACTCGAGTATTTGGCAAAGAAAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197991
EMC10 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197991.1-1321s21c1
Sequence:CCGGCCATGGTGACCTATCACTATCCTCGAGGATAGTGATAGGTCACCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-685s21c1
Sequence:CCGGCCACAGGAGCAGAAGTCTTTCCTCGAGGAAAGACTTCTGCTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-639s21c1
Sequence:CCGGCTTCATTGAGCGCCTGGAAATCTCGAGATTTCCAGGCGCTCAATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-566s21c1
Sequence:CCGGAGGACCTGGAGCTGTTCAATACTCGAGTATTGAACAGCTCCAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-199s21c1
Sequence:CCGGTTGCTGCTGGAGCATTCATTTCTCGAGAAATGAATGCTCCAGCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-711s1c1
Sequence:CCGGCAAATACTGGATGTACATCATCTCGAGATGATGTACATCCAGTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-694s1c1
Sequence:CCGGCAGAAGTCTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAAGACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-696s1c1
Sequence:CCGGGAAGTCTTTCTTTGCCAAATACTCGAGTATTTGGCAAAGAAAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197991
EMC10 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197991.1-1321s21c1
Sequence:CCGGCCATGGTGACCTATCACTATCCTCGAGGATAGTGATAGGTCACCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-685s21c1
Sequence:CCGGCCACAGGAGCAGAAGTCTTTCCTCGAGGAAAGACTTCTGCTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-639s21c1
Sequence:CCGGCTTCATTGAGCGCCTGGAAATCTCGAGATTTCCAGGCGCTCAATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-566s21c1
Sequence:CCGGAGGACCTGGAGCTGTTCAATACTCGAGTATTGAACAGCTCCAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197991.1-199s21c1
Sequence:CCGGTTGCTGCTGGAGCATTCATTTCTCGAGAAATGAATGCTCCAGCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-711s1c1
Sequence:CCGGCAAATACTGGATGTACATCATCTCGAGATGATGTACATCCAGTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-694s1c1
Sequence:CCGGCAGAAGTCTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAAGACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197991.1-696s1c1
Sequence:CCGGGAAGTCTTTCTTTGCCAAATACTCGAGTATTTGGCAAAGAAAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)