EMAIL THIS PAGE TO A FRIEND

EMC1

ER membrane protein complex subunit 1

57 Gene Product Result for
Synonyms: KIAA0090 RP1-43E13.1
Gene ID:
Human(23065) Summary: This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Mouse(230866) ER membrane protein complex subunit 1
Rat(362643) ER membrane protein complex subunit 1
Zebrafish(565399) ER membrane protein complex subunit 1
domestic cat(101089281) ER membrane protein complex subunit 1
cow(508439) ER membrane protein complex subunit 1
dog(612432) ER membrane protein complex subunit 1
chicken(419470) ER membrane protein complex subunit 1
sheep(101109679) ER membrane protein complex subunit 1
domestic guinea pig(100724663) ER membrane protein complex subunit 1
naked mole-rat(101700554) ER membrane protein complex subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015047 Rosetta Predictions human pricing
NM_001108690 Rosetta Predictions rat pricing
NM_001039200 Rosetta Predictions mouse pricing
NM_146157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090217 predicted 663
2 SASI_Hs01_00090218 predicted 3022
3 SASI_Hs01_00090219 predicted 1831
4 SASI_Hs01_00090221 predicted 1157
5 SASI_Hs01_00090222 predicted 2911
6 SASI_Hs01_00090223 predicted 1141
7 SASI_Hs01_00090224 predicted 2881
8 SASI_Hs02_00346890 predicted 2388
9 SASI_Hs01_00090225 predicted 1839
10 SASI_Hs02_00346891 predicted 2190
11 SASI_Hs01_00090220 predicted 2868
12 SASI_Hs01_00090226 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241115 predicted 301
2 SASI_Rn02_00241116 predicted 2986
3 SASI_Rn02_00241117 predicted 1173
4 SASI_Rn02_00241118 predicted 2409
5 SASI_Rn02_00241119 predicted 1143
6 SASI_Rn02_00241120 predicted 2870
7 SASI_Rn02_00241121 predicted 1129
8 SASI_Rn02_00241122 predicted 1685
9 SASI_Rn02_00241123 predicted 483
10 SASI_Rn02_00241124 predicted 2846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289941 predicted 1700
2 SASI_Mm02_00289942 predicted 612
3 SASI_Mm02_00289943 predicted 2989
4 SASI_Mm02_00289944 predicted 2076
5 SASI_Mm02_00289945 predicted 2083
6 SASI_Mm02_00289946 predicted 238
7 SASI_Mm02_00289947 predicted 2859
8 SASI_Mm02_00289948 predicted 2088
9 SASI_Mm02_00289949 predicted 3047
10 SASI_Mm02_00289950 predicted 2902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341844 predicted 1704
2 SASI_Mm02_00341845 predicted 611
3 SASI_Mm02_00341846 predicted 2998
4 SASI_Mm02_00341847 predicted 2078
5 SASI_Mm02_00341848 predicted 2094
6 SASI_Mm02_00341849 predicted 239
7 SASI_Mm02_00341850 predicted 2875
8 SASI_Mm02_00341851 predicted 2096
9 SASI_Mm02_00341852 predicted 3059
10 SASI_Mm02_00341853 predicted 2915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015047
VALIDATED
EMC1 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-958s1c1
Sequence:CCGGCCATTATGGAACGCTGAGTTTCTCGAGAAACTCAGCGTTCCATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-3714s1c1
Sequence:CCGGGCGTCTTGTTTGTTGCCCATTCTCGAGAATGGGCAACAAACAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-1765s1c1
Sequence:CCGGCCAGAGAACTACTGCTCATTTCTCGAGAAATGAGCAGTAGTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2758s1c1
Sequence:CCGGCGCAGAGCGATTCATCAACTACTCGAGTAGTTGATGAATCGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2759s1c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-3006s21c1
Sequence:CCGGTGAATCGGGCCTGGCGATAAACTCGAGTTTATCGCCAGGCCCGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2916s21c1
Sequence:CCGGATGACTATGACTACGTGTTAACTCGAGTTAACACGTAGTCATAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015047.1-3483s21c1
Sequence:CCGGTCCACCTTATAGGTACATTTGCTCGAGCAAATGTACCTATAAGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2759s21c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-1150s21c1
Sequence:CCGGCAATCAGACCTACACCATTAACTCGAGTTAATGGTGTAGGTCTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015047
VALIDATED
EMC1 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-958s1c1
Sequence:CCGGCCATTATGGAACGCTGAGTTTCTCGAGAAACTCAGCGTTCCATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-3714s1c1
Sequence:CCGGGCGTCTTGTTTGTTGCCCATTCTCGAGAATGGGCAACAAACAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-1765s1c1
Sequence:CCGGCCAGAGAACTACTGCTCATTTCTCGAGAAATGAGCAGTAGTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2758s1c1
Sequence:CCGGCGCAGAGCGATTCATCAACTACTCGAGTAGTTGATGAATCGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2759s1c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-3006s21c1
Sequence:CCGGTGAATCGGGCCTGGCGATAAACTCGAGTTTATCGCCAGGCCCGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2916s21c1
Sequence:CCGGATGACTATGACTACGTGTTAACTCGAGTTAACACGTAGTCATAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015047.1-3483s21c1
Sequence:CCGGTCCACCTTATAGGTACATTTGCTCGAGCAAATGTACCTATAAGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2759s21c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-1150s21c1
Sequence:CCGGCAATCAGACCTACACCATTAACTCGAGTTAATGGTGTAGGTCTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015047
VALIDATED
EMC1 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-958s1c1
Sequence:CCGGCCATTATGGAACGCTGAGTTTCTCGAGAAACTCAGCGTTCCATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-3714s1c1
Sequence:CCGGGCGTCTTGTTTGTTGCCCATTCTCGAGAATGGGCAACAAACAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-1765s1c1
Sequence:CCGGCCAGAGAACTACTGCTCATTTCTCGAGAAATGAGCAGTAGTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2758s1c1
Sequence:CCGGCGCAGAGCGATTCATCAACTACTCGAGTAGTTGATGAATCGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015047.1-2759s1c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-3006s21c1
Sequence:CCGGTGAATCGGGCCTGGCGATAAACTCGAGTTTATCGCCAGGCCCGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2916s21c1
Sequence:CCGGATGACTATGACTACGTGTTAACTCGAGTTAACACGTAGTCATAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015047.1-3483s21c1
Sequence:CCGGTCCACCTTATAGGTACATTTGCTCGAGCAAATGTACCTATAAGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-2759s21c1
Sequence:CCGGGCAGAGCGATTCATCAACTATCTCGAGATAGTTGATGAATCGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015047.1-1150s21c1
Sequence:CCGGCAATCAGACCTACACCATTAACTCGAGTTAATGGTGTAGGTCTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146157
VALIDATED
EMC1 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-220s1c1
Sequence:CCGGGCGTTAAATTCTCGGACTGGACTCGAGTCCAGTCCGAGAATTTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-2757s1c1
Sequence:CCGGGCGATTCATCAACTATAACCACTCGAGTGGTTATAGTTGATGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146157.2-1924s1c1
Sequence:CCGGCCAGTCATGGATCAAGACTATCTCGAGATAGTCTTGATCCATGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-129s1c1
Sequence:CCGGGCAGTATGTTGGGAAGATCAACTCGAGTTGATCTTCCCAACATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-2879s21c1
Sequence:CCGGTTTACCCGTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGACGGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-440s21c1
Sequence:CCGGAGGAGTCAGTGAGGTACATTGCTCGAGCAATGTACCTCACTGACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3405s21c1
Sequence:CCGGGAAATATTCTGACACCTTATTCTCGAGAATAAGGTGTCAGAATATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-1713s21c1
Sequence:CCGGGCAGTATCTGCCCAATGTTAACTCGAGTTAACATTGGGCAGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3239s21c1
Sequence:CCGGCCACTCCCTGTTCCCTTTATGCTCGAGCATAAAGGGAACAGGGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146157
VALIDATED
EMC1 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-220s1c1
Sequence:CCGGGCGTTAAATTCTCGGACTGGACTCGAGTCCAGTCCGAGAATTTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-2757s1c1
Sequence:CCGGGCGATTCATCAACTATAACCACTCGAGTGGTTATAGTTGATGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146157.2-1924s1c1
Sequence:CCGGCCAGTCATGGATCAAGACTATCTCGAGATAGTCTTGATCCATGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-129s1c1
Sequence:CCGGGCAGTATGTTGGGAAGATCAACTCGAGTTGATCTTCCCAACATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-2879s21c1
Sequence:CCGGTTTACCCGTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGACGGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-440s21c1
Sequence:CCGGAGGAGTCAGTGAGGTACATTGCTCGAGCAATGTACCTCACTGACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3405s21c1
Sequence:CCGGGAAATATTCTGACACCTTATTCTCGAGAATAAGGTGTCAGAATATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-1713s21c1
Sequence:CCGGGCAGTATCTGCCCAATGTTAACTCGAGTTAACATTGGGCAGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3239s21c1
Sequence:CCGGCCACTCCCTGTTCCCTTTATGCTCGAGCATAAAGGGAACAGGGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146157
VALIDATED
EMC1 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-220s1c1
Sequence:CCGGGCGTTAAATTCTCGGACTGGACTCGAGTCCAGTCCGAGAATTTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-2757s1c1
Sequence:CCGGGCGATTCATCAACTATAACCACTCGAGTGGTTATAGTTGATGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146157.2-1924s1c1
Sequence:CCGGCCAGTCATGGATCAAGACTATCTCGAGATAGTCTTGATCCATGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146157.2-129s1c1
Sequence:CCGGGCAGTATGTTGGGAAGATCAACTCGAGTTGATCTTCCCAACATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-2879s21c1
Sequence:CCGGTTTACCCGTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGACGGGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-440s21c1
Sequence:CCGGAGGAGTCAGTGAGGTACATTGCTCGAGCAATGTACCTCACTGACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3405s21c1
Sequence:CCGGGAAATATTCTGACACCTTATTCTCGAGAATAAGGTGTCAGAATATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146157.3-1713s21c1
Sequence:CCGGGCAGTATCTGCCCAATGTTAACTCGAGTTAACATTGGGCAGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146157.3-3239s21c1
Sequence:CCGGCCACTCCCTGTTCCCTTTATGCTCGAGCATAAAGGGAACAGGGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)