EMAIL THIS PAGE TO A FRIEND

EMC2

ER membrane protein complex subunit 2

60 Gene Product Result for
Synonyms: KIAA0103 TTC35
UniProtKB ID: Q15006, Q8WUE1
Gene ID:
Mouse(66736) ER membrane protein complex subunit 2
Rat(362905) ER membrane protein complex subunit 2
Zebrafish(407073) ER membrane protein complex subunit 2
chicken(420273) ER membrane protein complex subunit 2
cow(616813) tetratricopeptide repeat domain 35
domestic cat(101091252) ER membrane protein complex subunit 2
dog(612810) ER membrane protein complex subunit 2
sheep(101122607) ER membrane protein complex subunit 2
domestic guinea pig(100730698) ER membrane protein complex subunit 2
naked mole-rat(101696740) ER membrane protein complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014673 Rosetta Predictions human pricing
NM_001113785 Rosetta Predictions rat pricing
NM_025736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143070 predicted 961
2 SASI_Hs01_00143071 predicted 465
3 SASI_Hs01_00143072 predicted 327
4 SASI_Hs01_00143073 predicted 583
5 SASI_Hs01_00143074 predicted 526
6 SASI_Hs01_00143075 predicted 650
7 SASI_Hs01_00143077 predicted 831
8 SASI_Hs01_00143078 predicted 492
9 SASI_Hs01_00143079 predicted 738
10 SASI_Hs02_00346025 predicted 876
11 SASI_Hs01_00143076 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252103 predicted 863
2 SASI_Rn02_00252104 predicted 838
3 SASI_Rn02_00252105 predicted 846
4 SASI_Rn02_00252106 predicted 377
5 SASI_Rn02_00252107 predicted 362
6 SASI_Rn02_00252108 predicted 858
7 SASI_Rn02_00252109 predicted 827
8 SASI_Rn02_00252110 predicted 616
9 SASI_Rn02_00252111 predicted 709
10 SASI_Rn02_00252112 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051897 predicted 322
2 SASI_Mm01_00051898 predicted 854
3 SASI_Mm01_00051899 predicted 894
4 SASI_Mm01_00051900 predicted 631
5 SASI_Mm01_00051901 predicted 411
6 SASI_Mm01_00051903 predicted 644
7 SASI_Mm01_00051904 predicted 616
8 SASI_Mm01_00051905 predicted 356
9 SASI_Mm01_00051906 predicted 964
10 SASI_Mm02_00328918 predicted 898
11 SASI_Mm01_00051902 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014673
VALIDATED
EMC2 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014673.2-820s1c1
Sequence:CCGGGCTAGTCAAATAAACAGAGCTCTCGAGAGCTCTGTTTATTTGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014673.2-1042s1c1
Sequence:CCGGCTGTTAAGAAGGCAGTTGTAACTCGAGTTACAACTGCCTTCTTAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-743s1c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-309s1c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-978s1c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014673.2-133s1c1
Sequence:CCGGCAAATTGTGGAAGTTGGAGAACTCGAGTTCTCCAACTTCCACAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-739s21c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-840s21c1
Sequence:CCGGCAGTTTGCAGGTCGAAGTAAGCTCGAGCTTACTTCGACCTGCAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-305s21c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014673.3-345s21c1
Sequence:CCGGGATGATGCTATACAGCTATATCTCGAGATATAGCTGTATAGCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014673.3-974s21c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014673
VALIDATED
EMC2 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014673.2-820s1c1
Sequence:CCGGGCTAGTCAAATAAACAGAGCTCTCGAGAGCTCTGTTTATTTGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014673.2-1042s1c1
Sequence:CCGGCTGTTAAGAAGGCAGTTGTAACTCGAGTTACAACTGCCTTCTTAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-743s1c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-309s1c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-978s1c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014673.2-133s1c1
Sequence:CCGGCAAATTGTGGAAGTTGGAGAACTCGAGTTCTCCAACTTCCACAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-739s21c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-840s21c1
Sequence:CCGGCAGTTTGCAGGTCGAAGTAAGCTCGAGCTTACTTCGACCTGCAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-305s21c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014673.3-345s21c1
Sequence:CCGGGATGATGCTATACAGCTATATCTCGAGATATAGCTGTATAGCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014673.3-974s21c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014673
VALIDATED
EMC2 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014673.2-820s1c1
Sequence:CCGGGCTAGTCAAATAAACAGAGCTCTCGAGAGCTCTGTTTATTTGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014673.2-1042s1c1
Sequence:CCGGCTGTTAAGAAGGCAGTTGTAACTCGAGTTACAACTGCCTTCTTAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-743s1c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-309s1c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014673.2-978s1c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014673.2-133s1c1
Sequence:CCGGCAAATTGTGGAAGTTGGAGAACTCGAGTTCTCCAACTTCCACAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-739s21c1
Sequence:CCGGCGGCAAGTCATATTGCTTCTACTCGAGTAGAAGCAATATGACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-840s21c1
Sequence:CCGGCAGTTTGCAGGTCGAAGTAAGCTCGAGCTTACTTCGACCTGCAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014673.3-305s21c1
Sequence:CCGGGCGATTAACAGGCATGAGATTCTCGAGAATCTCATGCCTGTTAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014673.3-345s21c1
Sequence:CCGGGATGATGCTATACAGCTATATCTCGAGATATAGCTGTATAGCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014673.3-974s21c1
Sequence:CCGGGAACTTATTGGCCTGTAACTTCTCGAGAAGTTACAGGCCAATAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025736
VALIDATED
EMC2 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025736.1-1008s1c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-422s1c1
Sequence:CCGGGCTGCCAGAAAGCGTAAGATTCTCGAGAATCTTACGCTTTCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-260s1c1
Sequence:CCGGCGGGATGACTTGGCATTGTTTCTCGAGAAACAATGCCAAGTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-368s1c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-764s1c1
Sequence:CCGGGCAAGTCATATTGCTTCTAATCTCGAGATTAGAAGCAATATGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-885s21c1
Sequence:CCGGGGAAACCAAATACTCTCTTAACTCGAGTTAAGAGAGTATTTGGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-1007s21c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-367s21c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-531s21c1
Sequence:CCGGGCATGAACTTGCAGAACTTTACTCGAGTAAAGTTCTGCAAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025736.2-204s21c1
Sequence:CCGGGGATGACATTTGGATCATATACTCGAGTATATGATCCAAATGTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025736
VALIDATED
EMC2 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025736.1-1008s1c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-422s1c1
Sequence:CCGGGCTGCCAGAAAGCGTAAGATTCTCGAGAATCTTACGCTTTCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-260s1c1
Sequence:CCGGCGGGATGACTTGGCATTGTTTCTCGAGAAACAATGCCAAGTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-368s1c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-764s1c1
Sequence:CCGGGCAAGTCATATTGCTTCTAATCTCGAGATTAGAAGCAATATGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-885s21c1
Sequence:CCGGGGAAACCAAATACTCTCTTAACTCGAGTTAAGAGAGTATTTGGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-1007s21c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-367s21c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-531s21c1
Sequence:CCGGGCATGAACTTGCAGAACTTTACTCGAGTAAAGTTCTGCAAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025736.2-204s21c1
Sequence:CCGGGGATGACATTTGGATCATATACTCGAGTATATGATCCAAATGTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025736
VALIDATED
EMC2 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025736.1-1008s1c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-422s1c1
Sequence:CCGGGCTGCCAGAAAGCGTAAGATTCTCGAGAATCTTACGCTTTCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-260s1c1
Sequence:CCGGCGGGATGACTTGGCATTGTTTCTCGAGAAACAATGCCAAGTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-368s1c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025736.1-764s1c1
Sequence:CCGGGCAAGTCATATTGCTTCTAATCTCGAGATTAGAAGCAATATGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-885s21c1
Sequence:CCGGGGAAACCAAATACTCTCTTAACTCGAGTTAAGAGAGTATTTGGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-1007s21c1
Sequence:CCGGCCTGTGACTGAATTTACTAAACTCGAGTTTAGTAAATTCAGTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-367s21c1
Sequence:CCGGGACGATGCTATACAACTGTATCTCGAGATACAGTTGTATAGCATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025736.2-531s21c1
Sequence:CCGGGCATGAACTTGCAGAACTTTACTCGAGTAAAGTTCTGCAAGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025736.2-204s21c1
Sequence:CCGGGGATGACATTTGGATCATATACTCGAGTATATGATCCAAATGTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)