EMAIL THIS PAGE TO A FRIEND

EMC3

ER membrane protein complex subunit 3

52 Gene Product Result for
Synonyms: POB TMEM111
UniProtKB ID: Q9P0I2, B2R4Z9, Q53GH8, Q6ZMC2
Gene ID:
Mouse(66087) ER membrane protein complex subunit 3
Rat(312640) ER membrane protein complex subunit 3
naked mole-rat(101705316) ER membrane protein complex subunit 3
domestic guinea pig(100718083) ER membrane protein complex subunit 3
sheep(101101927) ER membrane protein complex subunit 3
Zebrafish(406826) ER membrane protein complex subunit 3
chicken(415936) ER membrane protein complex subunit 3
cow(508371) ER membrane protein complex subunit 3
domestic cat(101086127) ER membrane protein complex subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018447 Rosetta Predictions human pricing
NM_001008355 Rosetta Predictions rat pricing
NM_175101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231580 predicted 498
2 SASI_Hs01_00231581 predicted 488
3 SASI_Hs01_00231582 predicted 690
4 SASI_Hs01_00231583 predicted 476
5 SASI_Hs01_00231584 predicted 642
6 SASI_Hs01_00231585 predicted 383
7 SASI_Hs01_00231586 predicted 542
8 SASI_Hs01_00231587 predicted 720
9 SASI_Hs01_00231588 predicted 322
10 SASI_Hs01_00231589 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097251 predicted 224
2 SASI_Rn01_00097252 predicted 431
3 SASI_Rn01_00097253 predicted 644
4 SASI_Rn02_00199116 predicted 847
5 SASI_Rn01_00097254 predicted 779
6 SASI_Rn01_00097255 predicted 477
7 SASI_Rn01_00097256 predicted 652
8 SASI_Rn01_00097257 predicted 565
9 SASI_Rn01_00097258 predicted 747
10 SASI_Rn01_00097259 predicted 481
11 SASI_Rn01_00097260 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164965 predicted 1258
2 SASI_Mm01_00164966 predicted 1248
3 SASI_Mm01_00164968 predicted 659
4 SASI_Mm01_00164969 predicted 1234
5 SASI_Mm01_00164971 predicted 817
6 SASI_Mm01_00164973 predicted 887
7 SASI_Mm02_00345696 predicted 1194
8 SASI_Mm01_00164974 predicted 1229
9 SASI_Mm02_00345697 predicted 909
10 SASI_Mm02_00345698 predicted 966
11 SASI_Mm01_00164967 predicted 1440
12 SASI_Mm01_00164970 predicted 748
13 SASI_Mm01_00164972 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018447
VALIDATED
EMC3 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-318s21c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-876s21c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-504s21c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-812s21c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-744s1c1
Sequence:CCGGCAAGATAATGCCGCTGACCAACTCGAGTTGGTCAGCGGCATTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-828s1c1
Sequence:CCGGGCTTTCAAGACAGAGTGGGAACTCGAGTTCCCACTCTGTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-812s1c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-245s1c1
Sequence:CCGGCATCACTTTCTTCGTAGGCATCTCGAGATGCCTACGAAGAAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-313s1c1
Sequence:CCGGCCCAGGAACAAGTATCTGACACTCGAGTGTCAGATACTTGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-677s1c1
Sequence:CCGGGAGTTCTGCATCCTGGTACTTCTCGAGAAGTACCAGGATGCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-876s1c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-504s1c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018447.1-542s1c1
Sequence:CCGGGATTCTTATTGGTGGATGGATCTCGAGATCCATCCACCAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-318s1c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018447
VALIDATED
EMC3 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-318s21c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-876s21c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-504s21c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-812s21c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-744s1c1
Sequence:CCGGCAAGATAATGCCGCTGACCAACTCGAGTTGGTCAGCGGCATTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-828s1c1
Sequence:CCGGGCTTTCAAGACAGAGTGGGAACTCGAGTTCCCACTCTGTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-812s1c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-245s1c1
Sequence:CCGGCATCACTTTCTTCGTAGGCATCTCGAGATGCCTACGAAGAAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-313s1c1
Sequence:CCGGCCCAGGAACAAGTATCTGACACTCGAGTGTCAGATACTTGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-677s1c1
Sequence:CCGGGAGTTCTGCATCCTGGTACTTCTCGAGAAGTACCAGGATGCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-876s1c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-504s1c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018447.1-542s1c1
Sequence:CCGGGATTCTTATTGGTGGATGGATCTCGAGATCCATCCACCAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-318s1c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018447
VALIDATED
EMC3 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-318s21c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-876s21c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-504s21c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018447.1-812s21c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-744s1c1
Sequence:CCGGCAAGATAATGCCGCTGACCAACTCGAGTTGGTCAGCGGCATTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-828s1c1
Sequence:CCGGGCTTTCAAGACAGAGTGGGAACTCGAGTTCCCACTCTGTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-812s1c1
Sequence:CCGGCGCAGACACAAACAAAGCTTTCTCGAGAAAGCTTTGTTTGTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-245s1c1
Sequence:CCGGCATCACTTTCTTCGTAGGCATCTCGAGATGCCTACGAAGAAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-313s1c1
Sequence:CCGGCCCAGGAACAAGTATCTGACACTCGAGTGTCAGATACTTGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-677s1c1
Sequence:CCGGGAGTTCTGCATCCTGGTACTTCTCGAGAAGTACCAGGATGCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-876s1c1
Sequence:CCGGGCACTAGATGATGTCGAAGAACTCGAGTTCTTCGACATCATCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018447.1-504s1c1
Sequence:CCGGGACATGATGAAAGGGAATGTACTCGAGTACATTCCCTTTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018447.1-542s1c1
Sequence:CCGGGATTCTTATTGGTGGATGGATCTCGAGATCCATCCACCAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018447.1-318s1c1
Sequence:CCGGGAACAAGTATCTGACAGTCAACTCGAGTTGACTGTCAGATACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175101
VALIDATED
EMC3 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-366s21c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175101.3-210s21c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-918s21c1
Sequence:CCGGGGAACTACAGACGTCCATATTCTCGAGAATATGGACGTCTGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-1370s21c1
Sequence:CCGGCTTTCTTTACACACGTAATATCTCGAGATATTACGTGTGTAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-684s21c1
Sequence:CCGGGTTTGGGCTCCGGAGCATTTACTCGAGTAAATGCTCCGGAGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-515s1c1
Sequence:CCGGCCAATGATTCTTATCGGCGGACTCGAGTCCGCCGATAAGAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-367s1c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-605s1c1
Sequence:CCGGCCTATGCTTCAGCAAGGAATACTCGAGTATTCCTTGCTGAAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-211s1c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-1129s1c1
Sequence:CCGGGCTGTCTTAAAGTTTGTGATTCTCGAGAATCACAAACTTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175101
VALIDATED
EMC3 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-366s21c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175101.3-210s21c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-918s21c1
Sequence:CCGGGGAACTACAGACGTCCATATTCTCGAGAATATGGACGTCTGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-1370s21c1
Sequence:CCGGCTTTCTTTACACACGTAATATCTCGAGATATTACGTGTGTAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-684s21c1
Sequence:CCGGGTTTGGGCTCCGGAGCATTTACTCGAGTAAATGCTCCGGAGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-515s1c1
Sequence:CCGGCCAATGATTCTTATCGGCGGACTCGAGTCCGCCGATAAGAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-367s1c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-605s1c1
Sequence:CCGGCCTATGCTTCAGCAAGGAATACTCGAGTATTCCTTGCTGAAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-211s1c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-1129s1c1
Sequence:CCGGGCTGTCTTAAAGTTTGTGATTCTCGAGAATCACAAACTTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175101
VALIDATED
EMC3 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-366s21c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175101.3-210s21c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-918s21c1
Sequence:CCGGGGAACTACAGACGTCCATATTCTCGAGAATATGGACGTCTGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-1370s21c1
Sequence:CCGGCTTTCTTTACACACGTAATATCTCGAGATATTACGTGTGTAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175101.3-684s21c1
Sequence:CCGGGTTTGGGCTCCGGAGCATTTACTCGAGTAAATGCTCCGGAGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-515s1c1
Sequence:CCGGCCAATGATTCTTATCGGCGGACTCGAGTCCGCCGATAAGAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-367s1c1
Sequence:CCGGGCAGTCTTTCTTAACACGAAACTCGAGTTTCGTGTTAAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175101.2-605s1c1
Sequence:CCGGCCTATGCTTCAGCAAGGAATACTCGAGTATTCCTTGCTGAAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-211s1c1
Sequence:CCGGGCCCATCGTTATCATCACTTTCTCGAGAAAGTGATGATAACGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175101.2-1129s1c1
Sequence:CCGGGCTGTCTTAAAGTTTGTGATTCTCGAGAATCACAAACTTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks