EMAIL THIS PAGE TO A FRIEND

EMC4

ER membrane protein complex subunit 4

85 Gene Product Result for
Synonyms: PIG17 TMEM85
UniProtKB ID: Q5J8M3, A8K3A9, B4DJQ4, Q96KX9, Q9BUI5, Q9P0T9
Gene ID:
Mouse(68032) ER membrane protein complex subunit 4
Rat(296049) ER membrane protein complex subunit 4
Zebrafish(402956) ER membrane protein complex subunit 4
dog(478241) ER membrane protein complex subunit 4
cow(523162) transmembrane protein 85
domestic cat(101097984) ER membrane protein complex subunit 4
chicken(100857962) ER membrane protein complex subunit 4
sheep(101122789) ER membrane protein complex subunit 4
domestic guinea pig(100729193) ER membrane protein complex subunit 4
naked mole-rat(101717145) ER membrane protein complex subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016454 Rosetta Predictions human pricing
NM_001106495 Rosetta Predictions rat pricing
NM_026519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036796 predicted 358
2 SASI_Hs01_00036797 predicted 224
3 SASI_Hs01_00036798 predicted 654
4 SASI_Hs01_00036800 predicted 306
5 SASI_Hs01_00036801 predicted 488
6 SASI_Hs01_00036802 predicted 544
7 SASI_Hs01_00036803 predicted 491
8 SASI_Hs01_00036804 predicted 693
9 SASI_Hs01_00036805 predicted 554
10 SASI_Hs02_00349492 predicted 653
11 SASI_Hs01_00036799 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219528 predicted 726
2 SASI_Rn02_00219529 predicted 842
3 SASI_Rn02_00219530 predicted 516
4 SASI_Rn02_00219531 predicted 412
5 SASI_Rn02_00219532 predicted 243
6 SASI_Rn02_00219533 predicted 599
7 SASI_Rn02_00219534 predicted 393
8 SASI_Rn02_00219535 predicted 351
9 SASI_Rn02_00219536 predicted 388
10 SASI_Rn02_00219537 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027583 predicted 413
2 SASI_Mm01_00027584 predicted 512
3 SASI_Mm02_00330429 predicted 549
4 SASI_Mm01_00027585 predicted 253
5 SASI_Mm01_00027586 predicted 714
6 SASI_Mm01_00027587 predicted 542
7 SASI_Mm01_00027590 predicted 603
8 SASI_Mm01_00027591 predicted 603
9 SASI_Mm02_00330430 predicted 549
10 SASI_Mm01_00027592 predicted 640
11 SASI_Mm01_00027588 predicted 694
12 SASI_Mm01_00027589 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016454
VALIDATED
EMC4 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-362s1c1
Sequence:CCGGCCCTACTATGATGGTGTGTATCTCGAGATACACACCATCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-465s1c1
Sequence:CCGGCAGGGTTTGGTCTATCTCATTCTCGAGAATGAGATAGACCAAACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-204s1c1
Sequence:CCGGGTCGGTTACTTGGACAAGCAACTCGAGTTGCTTGTCCAAGTAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-582s1c1
Sequence:CCGGCCTGAGAGAATGGAGTTCAGTCTCGAGACTGAACTCCATTCTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-535s1c1
Sequence:CCGGGACTGTTACCTACACATGCATCTCGAGATGCATGTGTAGGTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016454.2-646s1c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-441s1c1
Sequence:CCGGGAAAGTTCAAGCCAGAAGTTTCTCGAGAAACTTCTGGCTTGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-308s1c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-466s21c1
Sequence:CCGGAGGGTTTGGTCTATCTCATTGCTCGAGCAATGAGATAGACCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-646s21c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-308s21c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-351s21c1
Sequence:CCGGATCTCCATCTTCCCTACTATGCTCGAGCATAGTAGGGAAGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016454
VALIDATED
EMC4 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-362s1c1
Sequence:CCGGCCCTACTATGATGGTGTGTATCTCGAGATACACACCATCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-465s1c1
Sequence:CCGGCAGGGTTTGGTCTATCTCATTCTCGAGAATGAGATAGACCAAACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-204s1c1
Sequence:CCGGGTCGGTTACTTGGACAAGCAACTCGAGTTGCTTGTCCAAGTAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-582s1c1
Sequence:CCGGCCTGAGAGAATGGAGTTCAGTCTCGAGACTGAACTCCATTCTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-535s1c1
Sequence:CCGGGACTGTTACCTACACATGCATCTCGAGATGCATGTGTAGGTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016454.2-646s1c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-441s1c1
Sequence:CCGGGAAAGTTCAAGCCAGAAGTTTCTCGAGAAACTTCTGGCTTGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-308s1c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-466s21c1
Sequence:CCGGAGGGTTTGGTCTATCTCATTGCTCGAGCAATGAGATAGACCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-646s21c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-308s21c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-351s21c1
Sequence:CCGGATCTCCATCTTCCCTACTATGCTCGAGCATAGTAGGGAAGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016454
VALIDATED
EMC4 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-362s1c1
Sequence:CCGGCCCTACTATGATGGTGTGTATCTCGAGATACACACCATCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-465s1c1
Sequence:CCGGCAGGGTTTGGTCTATCTCATTCTCGAGAATGAGATAGACCAAACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-204s1c1
Sequence:CCGGGTCGGTTACTTGGACAAGCAACTCGAGTTGCTTGTCCAAGTAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-582s1c1
Sequence:CCGGCCTGAGAGAATGGAGTTCAGTCTCGAGACTGAACTCCATTCTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-535s1c1
Sequence:CCGGGACTGTTACCTACACATGCATCTCGAGATGCATGTGTAGGTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016454.2-646s1c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016454.2-441s1c1
Sequence:CCGGGAAAGTTCAAGCCAGAAGTTTCTCGAGAAACTTCTGGCTTGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016454.2-308s1c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-466s21c1
Sequence:CCGGAGGGTTTGGTCTATCTCATTGCTCGAGCAATGAGATAGACCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016454.2-646s21c1
Sequence:CCGGCCCTATGTATTTGGGTCTTATCTCGAGATAAGACCCAAATACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-308s21c1
Sequence:CCGGGATTCCCATGAATCTCTTCATCTCGAGATGAAGAGATTCATGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016454.2-351s21c1
Sequence:CCGGATCTCCATCTTCCCTACTATGCTCGAGCATAGTAGGGAAGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026519
VALIDATED
EMC4 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-358s1c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-480s1c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-370s1c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-494s1c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-522s1c1
Sequence:CCGGGCTTGGTCTATCTCATTGGGACTCGAGTCCCAATGAGATAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-402s1c1
Sequence:CCGGCCATTTCCATCTTCCCTACTACTCGAGTAGTAGGGAAGATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-726s1c1
Sequence:CCGGGACTCCTAAATATCCTCCCTTCTCGAGAAGGGAGGATATTTAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-823s1c1
Sequence:CCGGCAGCACAACTTATGACTGAAACTCGAGTTTCAGTCATAAGTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-479s21c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-369s21c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-357s21c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-493s21c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026519
VALIDATED
EMC4 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-358s1c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-480s1c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-370s1c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-494s1c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-522s1c1
Sequence:CCGGGCTTGGTCTATCTCATTGGGACTCGAGTCCCAATGAGATAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-402s1c1
Sequence:CCGGCCATTTCCATCTTCCCTACTACTCGAGTAGTAGGGAAGATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-726s1c1
Sequence:CCGGGACTCCTAAATATCCTCCCTTCTCGAGAAGGGAGGATATTTAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-823s1c1
Sequence:CCGGCAGCACAACTTATGACTGAAACTCGAGTTTCAGTCATAAGTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-479s21c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-369s21c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-357s21c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-493s21c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026519
VALIDATED
EMC4 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-358s1c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-480s1c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-370s1c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026519.1-494s1c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-522s1c1
Sequence:CCGGGCTTGGTCTATCTCATTGGGACTCGAGTCCCAATGAGATAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026519.1-402s1c1
Sequence:CCGGCCATTTCCATCTTCCCTACTACTCGAGTAGTAGGGAAGATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-726s1c1
Sequence:CCGGGACTCCTAAATATCCTCCCTTCTCGAGAAGGGAGGATATTTAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026519.1-823s1c1
Sequence:CCGGCAGCACAACTTATGACTGAAACTCGAGTTTCAGTCATAAGTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-479s21c1
Sequence:CCGGCTTTCAAGATGCTGGAGAGTTCTCGAGAACTCTCCAGCATCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-369s21c1
Sequence:CCGGGAACCTCTTCATCATGTACATCTCGAGATGTACATGATGAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-357s21c1
Sequence:CCGGGCAGATTCCCATGAACCTCTTCTCGAGAAGAGGTTCATGGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026519.3-493s21c1
Sequence:CCGGGAGAGTTCAAGTCAGAAGTTTCTCGAGAAACTTCTGACTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks