EMAIL THIS PAGE TO A FRIEND

EMC6

ER membrane protein complex subunit 6

Synonyms: TMEM93
UniProtKB ID: Q9BV81
Gene ID:
Mouse(66048) ER membrane protein complex subunit 6
Rat(287477) ER membrane protein complex subunit 6
naked mole-rat(101722603) ER membrane protein complex subunit 6
domestic guinea pig(100728801) ER membrane protein complex subunit 6
sheep(101123475) ER membrane protein complex subunit 6
Zebrafish(337220) ER membrane protein complex subunit 6
chicken(417604) ER membrane protein complex subunit 6
domestic cat(101092064) ER membrane protein complex subunit 6
cow(613551) transmembrane protein 93
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062681 Anti-EMC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1303404 ANTI-TMEM93 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2102478 Anti-TMEM93 antibody produced in rabbit affinity isolated antibody guinea pig, horse, canine, human, rat, zebrafish, bovine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031298 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014764 Rosetta Predictions human pricing
NM_031298 Rosetta Predictions human pricing
NM_001105806 Rosetta Predictions rat pricing
NM_025318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241206 predicted 469
2 SASI_Hs01_00241207 predicted 468
3 SASI_Hs01_00241208 predicted 473
4 SASI_Hs01_00241209 predicted 539
5 SASI_Hs01_00241210 predicted 471
6 SASI_Hs01_00241211 predicted 507
7 SASI_Hs01_00241212 predicted 550
8 SASI_Hs01_00241213 predicted 483
9 SASI_Hs01_00241214 predicted 498
10 SASI_Hs01_00241215 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076089 predicted 359
2 SASI_Hs01_00076090 predicted 353
3 SASI_Hs01_00076091 predicted 361
4 SASI_Hs01_00076092 predicted 423
5 SASI_Hs01_00076093 predicted 360
6 SASI_Hs01_00076094 predicted 394
7 SASI_Hs01_00076095 predicted 443
8 SASI_Hs01_00076096 predicted 364
9 SASI_Hs01_00076097 predicted 389
10 SASI_Hs01_00076098 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212716 predicted 254
2 SASI_Rn02_00212717 predicted 281
3 SASI_Rn02_00212718 predicted 288
4 SASI_Rn02_00212719 predicted 303
5 SASI_Rn02_00212720 predicted 306
6 SASI_Rn02_00212721 predicted 371
7 SASI_Rn02_00212722 predicted 265
8 SASI_Rn02_00212723 predicted 357
9 SASI_Rn02_00212724 predicted 307
10 SASI_Rn02_00212725 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112324 predicted 769
2 SASI_Mm01_00112325 predicted 779
3 SASI_Mm01_00112326 predicted 218
4 SASI_Mm01_00112327 predicted 882
5 SASI_Mm01_00112328 predicted 836
6 SASI_Mm01_00112329 predicted 829
7 SASI_Mm02_00327955 predicted 846
8 SASI_Mm01_00112331 predicted 632
9 SASI_Mm01_00112332 predicted 940
10 SASI_Mm01_00112333 predicted 748
11 SASI_Mm01_00112330 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025318
EMC6 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025318.2-573s21c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-177s21c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-355s21c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-397s21c1
Sequence:CCGGTCTTTACGGGAGGCCTCATTGCTCGAGCAATGAGGCCTCCCGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-462s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025318.1-574s1c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-178s1c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-356s1c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-344s1c1
Sequence:CCGGTCATTCTCAAAGCGGGAAGGACTCGAGTCCTTCCCGCTTTGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025318
EMC6 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025318.2-573s21c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-177s21c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-355s21c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-397s21c1
Sequence:CCGGTCTTTACGGGAGGCCTCATTGCTCGAGCAATGAGGCCTCCCGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-462s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025318.1-574s1c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-178s1c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-356s1c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-344s1c1
Sequence:CCGGTCATTCTCAAAGCGGGAAGGACTCGAGTCCTTCCCGCTTTGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025318
EMC6 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025318.2-573s21c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-177s21c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-355s21c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-397s21c1
Sequence:CCGGTCTTTACGGGAGGCCTCATTGCTCGAGCAATGAGGCCTCCCGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025318.2-462s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025318.1-574s1c1
Sequence:CCGGCGCTGCTTGTTCTGTACTGTTCTCGAGAACAGTACAGAACAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-178s1c1
Sequence:CCGGCCGCCGTTCATCAGCGAGGCACTCGAGTGCCTCGCTGATGAACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-356s1c1
Sequence:CCGGCGGGAAGGAGGTGGAACAAATCTCGAGATTTGTTCCACCTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025318.1-344s1c1
Sequence:CCGGTCATTCTCAAAGCGGGAAGGACTCGAGTCCTTCCCGCTTTGAGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031298
VALIDATED
EMC6 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-296s21c1
Sequence:CCGGGCCTCTACGGCTTCATCTTCTCTCGAGAGAAGATGAAGCCGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-364s21c1
Sequence:CCGGGGAAGGAGGTGGAACAAATATCTCGAGATATTTGTTCCACCTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-469s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-390s21c1
Sequence:CCGGATCACGGAGACCTCTCTTTACCTCGAGGTAAAGAGAGGTCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-536s21c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-350s1c1
Sequence:CCGGGAGGTGGAACAAATATTTCAACTCGAGTTGAAATATTTGTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-278s1c1
Sequence:CCGGCCTCTACGGCTTCATCTTCTACTCGAGTAGAAGATGAAGCCGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031298.2-536s1c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031298
VALIDATED
EMC6 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-296s21c1
Sequence:CCGGGCCTCTACGGCTTCATCTTCTCTCGAGAGAAGATGAAGCCGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-364s21c1
Sequence:CCGGGGAAGGAGGTGGAACAAATATCTCGAGATATTTGTTCCACCTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-469s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-390s21c1
Sequence:CCGGATCACGGAGACCTCTCTTTACCTCGAGGTAAAGAGAGGTCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-536s21c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-350s1c1
Sequence:CCGGGAGGTGGAACAAATATTTCAACTCGAGTTGAAATATTTGTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-278s1c1
Sequence:CCGGCCTCTACGGCTTCATCTTCTACTCGAGTAGAAGATGAAGCCGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031298.2-536s1c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031298
VALIDATED
EMC6 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-296s21c1
Sequence:CCGGGCCTCTACGGCTTCATCTTCTCTCGAGAGAAGATGAAGCCGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-364s21c1
Sequence:CCGGGGAAGGAGGTGGAACAAATATCTCGAGATATTTGTTCCACCTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-469s21c1
Sequence:CCGGATGGTGCACGTCTACTGAAATCTCGAGATTTCAGTAGACGTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-390s21c1
Sequence:CCGGATCACGGAGACCTCTCTTTACCTCGAGGTAAAGAGAGGTCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031298.2-536s21c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-350s1c1
Sequence:CCGGGAGGTGGAACAAATATTTCAACTCGAGTTGAAATATTTGTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031298.1-278s1c1
Sequence:CCGGCCTCTACGGCTTCATCTTCTACTCGAGTAGAAGATGAAGCCGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031298.2-536s1c1
Sequence:CCGGGCCAGCAATTAACACCATGTACTCGAGTACATGGTGTTAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks