EMAIL THIS PAGE TO A FRIEND

EMC7

ER membrane protein complex subunit 7

59 Gene Product Result for
Synonyms: C11orf3 C15orf24 ORF1-FL1
UniProtKB ID: Q9NPA0, B2RC00, Q96ED5
Gene ID:
Mouse(73024) ER membrane protein complex subunit 7
Zebrafish(561549) ER membrane protein complex subunit 7
cow(615423) chromosome 10 open reading frame, human C15orf24
domestic cat(101097489) ER membrane protein complex subunit 7
dog(478242) ER membrane protein complex subunit 7
sheep(101123302) ER membrane protein complex subunit 7
domestic guinea pig(100730015) ER membrane protein complex subunit 7
naked mole-rat(101718863) ER membrane protein complex subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020154 Rosetta Predictions human pricing
NM_133749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076199 predicted 416
2 SASI_Hs01_00076200 predicted 282
3 SASI_Hs01_00076202 predicted 486
4 SASI_Hs01_00076203 predicted 591
5 SASI_Hs01_00076204 predicted 320
6 SASI_Hs01_00076205 predicted 267
7 SASI_Hs02_00353049 predicted 361
8 SASI_Hs01_00076206 predicted 299
9 SASI_Hs01_00076207 predicted 587
10 SASI_Hs01_00076208 predicted 651
11 SASI_Hs01_00076201 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338736 predicted 422
2 SASI_Mm01_00110947 predicted 389
3 SASI_Mm01_00110949 predicted 287
4 SASI_Mm01_00110950 predicted 312
5 SASI_Mm01_00110951 predicted 517
6 SASI_Mm01_00110952 predicted 300
7 SASI_Mm01_00110953 predicted 628
8 SASI_Mm01_00110954 predicted 474
9 SASI_Mm01_00110955 predicted 835
10 SASI_Mm01_00110956 predicted 716
11 SASI_Mm01_00110948 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020154
VALIDATED
EMC7 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-544s1c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-634s1c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020154.1-133s1c1
Sequence:CCGGCATAGGAGATCGCTTCAAGATCTCGAGATCTTGAAGCGATCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-590s1c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-236s1c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020154.1-338s1c1
Sequence:CCGGCGAGTGGATATCACTTCGAAACTCGAGTTTCGAAGTGATATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020154.2-810s21c1
Sequence:CCGGCCGTGTGAAGCAACTACTATACTCGAGTATAGTAGTTGCTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020154.2-634s21c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-544s21c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-590s21c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-236s21c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020154
VALIDATED
EMC7 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-544s1c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-634s1c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020154.1-133s1c1
Sequence:CCGGCATAGGAGATCGCTTCAAGATCTCGAGATCTTGAAGCGATCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-590s1c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-236s1c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020154.1-338s1c1
Sequence:CCGGCGAGTGGATATCACTTCGAAACTCGAGTTTCGAAGTGATATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020154.2-810s21c1
Sequence:CCGGCCGTGTGAAGCAACTACTATACTCGAGTATAGTAGTTGCTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020154.2-634s21c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-544s21c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-590s21c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-236s21c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020154
VALIDATED
EMC7 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-544s1c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-634s1c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020154.1-133s1c1
Sequence:CCGGCATAGGAGATCGCTTCAAGATCTCGAGATCTTGAAGCGATCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-590s1c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020154.1-236s1c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020154.1-338s1c1
Sequence:CCGGCGAGTGGATATCACTTCGAAACTCGAGTTTCGAAGTGATATCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020154.2-810s21c1
Sequence:CCGGCCGTGTGAAGCAACTACTATACTCGAGTATAGTAGTTGCTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020154.2-634s21c1
Sequence:CCGGGCCTGATGTTTCTGAGTTCATCTCGAGATGAACTCAGAAACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-544s21c1
Sequence:CCGGGCTTCTGCCTAAAGTGGTCAACTCGAGTTGACCACTTTAGGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-590s21c1
Sequence:CCGGGAAATGGAGCAGTCAATGAATCTCGAGATTCATTGACTGCTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020154.2-236s21c1
Sequence:CCGGGTCGGTTTCCTTAAGACAGATCTCGAGATCTGTCTTAAGGAAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133749
VALIDATED
EMC7 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-438s1c1
Sequence:CCGGCCCTATCCTCTCCAAATGAAACTCGAGTTTCATTTGGAGAGGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-518s1c1
Sequence:CCGGGATGAACCCAATGGTTATGATCTCGAGATCATAACCATTGGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-831s1c1
Sequence:CCGGCGTGTGAAGTGACTACTGTAACTCGAGTTACAGTAGTCACTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-389s1c1
Sequence:CCGGGCGAGCAAGATATGTGAATTACTCGAGTAATTCACATATCTTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133749
VALIDATED
EMC7 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-438s1c1
Sequence:CCGGCCCTATCCTCTCCAAATGAAACTCGAGTTTCATTTGGAGAGGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-518s1c1
Sequence:CCGGGATGAACCCAATGGTTATGATCTCGAGATCATAACCATTGGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-831s1c1
Sequence:CCGGCGTGTGAAGTGACTACTGTAACTCGAGTTACAGTAGTCACTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-389s1c1
Sequence:CCGGGCGAGCAAGATATGTGAATTACTCGAGTAATTCACATATCTTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133749
VALIDATED
EMC7 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-438s1c1
Sequence:CCGGCCCTATCCTCTCCAAATGAAACTCGAGTTTCATTTGGAGAGGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-518s1c1
Sequence:CCGGGATGAACCCAATGGTTATGATCTCGAGATCATAACCATTGGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-831s1c1
Sequence:CCGGCGTGTGAAGTGACTACTGTAACTCGAGTTACAGTAGTCACTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133749.1-389s1c1
Sequence:CCGGGCGAGCAAGATATGTGAATTACTCGAGTAATTCACATATCTTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks