EMAIL THIS PAGE TO A FRIEND

EMC8

ER membrane protein complex subunit 8

72 Gene Product Result for
Synonyms: C16orf2 C16orf4 COX4NB FAM158B NOC4
UniProtKB ID: O43402, C9JB21
Gene ID:
Mouse(18117) ER membrane protein complex subunit 8
Rat(361425) ER membrane protein complex subunit 8
naked mole-rat(101705244) ER membrane protein complex subunit 8
domestic guinea pig(100725064) ER membrane protein complex subunit 8
sheep(101104926) ER membrane protein complex subunit 8
Zebrafish(406679) ER membrane protein complex subunit 8
cow(510727) COX4 neighbor
domestic cat(101093733) ER membrane protein complex subunit 8
chicken(415825) ER membrane protein complex subunit 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006067 Rosetta Predictions human pricing
NM_001012165 Rosetta Predictions rat pricing
XM_574247 Rosetta Predictions rat pricing
NM_010926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221592 predicted 465
2 SASI_Hs01_00221593 predicted 856
3 SASI_Hs01_00221594 predicted 425
4 SASI_Hs01_00221595 predicted 789
5 SASI_Hs02_00340833 predicted 801
6 SASI_Hs01_00221596 predicted 917
7 SASI_Hs01_00221598 predicted 481
8 SASI_Hs01_00221599 predicted 450
9 SASI_Hs01_00221600 predicted 613
10 SASI_Hs02_00340834 predicted 731
11 SASI_Hs01_00221597 predicted 734
12 SASI_Hs01_00221601 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046437 predicted 710
2 SASI_Rn01_00046438 predicted 639
3 SASI_Rn01_00046439 predicted 364
4 SASI_Rn01_00046440 predicted 250
5 SASI_Rn01_00046441 predicted 405
6 SASI_Rn01_00046442 predicted 325
7 SASI_Rn02_00200360 predicted 341
8 SASI_Rn01_00046443 predicted 701
9 SASI_Rn01_00046444 predicted 745
10 SASI_Rn01_00046445 predicted 761
11 SASI_Rn01_00046436 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124800 predicted 584
2 SASI_Rn01_00124801 predicted 785
3 SASI_Rn01_00124802 predicted 709
4 SASI_Rn01_00124803 predicted 433
5 SASI_Rn01_00124804 predicted 323
6 SASI_Rn01_00124805 predicted 481
7 SASI_Rn01_00124806 predicted 401
8 SASI_Rn01_00124807 predicted 770
9 SASI_Rn01_00124808 predicted 817
10 SASI_Rn01_00124809 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105732 predicted 359
2 SASI_Mm01_00105733 predicted 348
3 SASI_Mm01_00105734 predicted 586
4 SASI_Mm01_00105735 predicted 595
5 SASI_Mm01_00105736 predicted 732
6 SASI_Mm01_00105737 predicted 543
7 SASI_Mm01_00105738 predicted 952
8 SASI_Mm01_00105739 predicted 766
9 SASI_Mm01_00105740 predicted 200
10 SASI_Mm01_00105741 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006067
EMC8 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-504s21c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-793s21c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-835s21c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-812s21c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-800s1c1
Sequence:CCGGGAGATCAATAAAGCTGTCCTACTCGAGTAGGACAGCTTTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-805s1c1
Sequence:CCGGCAATAAAGCTGTCCTACACTTCTCGAGAAGTGTAGGACAGCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-445s1c1
Sequence:CCGGCAAAGATCATAGCTACGTGATCTCGAGATCACGTAGCTATGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-456s1c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006067.3-861s1c1
Sequence:CCGGCCTTTCCACTACGTTGAAGAACTCGAGTTCTTCAACGTAGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1669s1c1
Sequence:CCGGCCTTAGGGAATTGAGAGGGAACTCGAGTTCCCTCTCAATTCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1753s1c1
Sequence:CCGGCGGTACCTTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-787s1c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-745s1c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-764s1c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-492s1c1
Sequence:CCGGGAGTAAAGGATGCCAGTCCAACTCGAGTTGGACTGGCATCCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006067
EMC8 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-504s21c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-793s21c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-835s21c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-812s21c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-800s1c1
Sequence:CCGGGAGATCAATAAAGCTGTCCTACTCGAGTAGGACAGCTTTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-805s1c1
Sequence:CCGGCAATAAAGCTGTCCTACACTTCTCGAGAAGTGTAGGACAGCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-445s1c1
Sequence:CCGGCAAAGATCATAGCTACGTGATCTCGAGATCACGTAGCTATGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-456s1c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006067.3-861s1c1
Sequence:CCGGCCTTTCCACTACGTTGAAGAACTCGAGTTCTTCAACGTAGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1669s1c1
Sequence:CCGGCCTTAGGGAATTGAGAGGGAACTCGAGTTCCCTCTCAATTCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1753s1c1
Sequence:CCGGCGGTACCTTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-787s1c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-745s1c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-764s1c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-492s1c1
Sequence:CCGGGAGTAAAGGATGCCAGTCCAACTCGAGTTGGACTGGCATCCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006067
EMC8 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-504s21c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-793s21c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-835s21c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006067.4-812s21c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-800s1c1
Sequence:CCGGGAGATCAATAAAGCTGTCCTACTCGAGTAGGACAGCTTTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-805s1c1
Sequence:CCGGCAATAAAGCTGTCCTACACTTCTCGAGAAGTGTAGGACAGCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-445s1c1
Sequence:CCGGCAAAGATCATAGCTACGTGATCTCGAGATCACGTAGCTATGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-456s1c1
Sequence:CCGGGCTACGTGATTGCTGGTTATTCTCGAGAATAACCAGCAATCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006067.3-861s1c1
Sequence:CCGGCCTTTCCACTACGTTGAAGAACTCGAGTTCTTCAACGTAGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1669s1c1
Sequence:CCGGCCTTAGGGAATTGAGAGGGAACTCGAGTTCCCTCTCAATTCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006067.3-1753s1c1
Sequence:CCGGCGGTACCTTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-787s1c1
Sequence:CCGGCTGGACAAACCCAGAGATCAACTCGAGTTGATCTCTGGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-745s1c1
Sequence:CCGGGCTCGTGGATTTCGATAACCACTCGAGTGGTTATCGAAATCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006067.3-764s1c1
Sequence:CCGGCACCTGGATGACATTCGGAATCTCGAGATTCCGAATGTCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006067.3-492s1c1
Sequence:CCGGGAGTAAAGGATGCCAGTCCAACTCGAGTTGGACTGGCATCCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010926
VALIDATED
EMC8 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010926.5-775s21c1
Sequence:CCGGAGCGAAGACGGAAGCATATTTCTCGAGAAATATGCTTCCGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-661s21c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-382s21c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-684s21c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-406s1c1
Sequence:CCGGCCAAGCTAATGAGCGTGTGAACTCGAGTTCACACGCTCATTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-384s1c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-663s1c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-686s1c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010926
VALIDATED
EMC8 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010926.5-775s21c1
Sequence:CCGGAGCGAAGACGGAAGCATATTTCTCGAGAAATATGCTTCCGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-661s21c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-382s21c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-684s21c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-406s1c1
Sequence:CCGGCCAAGCTAATGAGCGTGTGAACTCGAGTTCACACGCTCATTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-384s1c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-663s1c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-686s1c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010926
VALIDATED
EMC8 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010926.5-775s21c1
Sequence:CCGGAGCGAAGACGGAAGCATATTTCTCGAGAAATATGCTTCCGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-661s21c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-382s21c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010926.5-684s21c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-406s1c1
Sequence:CCGGCCAAGCTAATGAGCGTGTGAACTCGAGTTCACACGCTCATTAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-384s1c1
Sequence:CCGGGCTATGTGATCGCTGGCTATTCTCGAGAATAGCCAGCGATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-663s1c1
Sequence:CCGGCCTACGAAACACTCGTGGATTCTCGAGAATCCACGAGTGTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010926.1-686s1c1
Sequence:CCGGGATAATCATCTGGACGACATTCTCGAGAATGTCGTCCAGATGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks