EMAIL THIS PAGE TO A FRIEND

EMC9

ER membrane protein complex subunit 9

50 Gene Product Result for
Synonyms: C14orf122 FAM158A
UniProtKB ID: Q9Y3B6, D3DS60, Q9BUM3
Gene ID:
Mouse(85308) ER membrane protein complex subunit 9
Rat(290224) ER membrane protein complex subunit 9
Zebrafish(393094) ER membrane protein complex subunit 9
domestic cat(101100218) ER membrane protein complex subunit 9
cow(509858) ER membrane protein complex subunit 9
dog(480257) ER membrane protein complex subunit 9
sheep(101117671) ER membrane protein complex subunit 9
domestic guinea pig(100714414) ER membrane protein complex subunit 9
naked mole-rat(101703702) ER membrane protein complex subunit 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016049 Rosetta Predictions human pricing
NM_001008296 Rosetta Predictions rat pricing
NM_033146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110068 predicted 490
2 SASI_Hs01_00110069 predicted 576
3 SASI_Hs01_00110070 predicted 486
4 SASI_Hs01_00110071 predicted 492
5 SASI_Hs01_00110072 predicted 580
6 SASI_Hs01_00110073 predicted 412
7 SASI_Hs01_00110074 predicted 202
8 SASI_Hs01_00110075 predicted 477
9 SASI_Hs01_00110076 predicted 408
10 SASI_Hs01_00110077 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040142 predicted 512
2 SASI_Rn01_00040143 predicted 335
3 SASI_Rn01_00040144 predicted 306
4 SASI_Rn01_00040145 predicted 481
5 SASI_Rn01_00040146 predicted 218
6 SASI_Rn01_00040147 predicted 526
7 SASI_Rn01_00040148 predicted 300
8 SASI_Rn01_00040149 predicted 485
9 SASI_Rn01_00040150 predicted 573
10 SASI_Rn01_00040151 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337292 predicted 326
2 SASI_Mm02_00337293 predicted 359
3 SASI_Mm02_00337294 predicted 301
4 SASI_Mm02_00337295 predicted 550
5 SASI_Mm02_00337296 predicted 472
6 SASI_Mm02_00337297 predicted 473
7 SASI_Mm02_00337298 predicted 479
8 SASI_Mm02_00337299 predicted 214
9 SASI_Mm02_00337300 predicted 368
10 SASI_Mm02_00337301 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016049
VALIDATED
EMC9 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-398s1c1
Sequence:CCGGGCTGGTTACTACCATGCCAATCTCGAGATTGGCATGGTAGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-683s1c1
Sequence:CCGGGACTTTGACTGCCACCTTGATCTCGAGATCAAGGTGGCAGTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-588s1c1
Sequence:CCGGCTAAGGATAAGAACTTAGTGACTCGAGTCACTAAGTTCTTATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-512s1c1
Sequence:CCGGGATAATCAGAAACTGGTGCCTCTCGAGAGGCACCAGTTTCTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-733s1c1
Sequence:CCGGGCTCAACACTCAAATCACCCACTCGAGTGGGTGATTTGAGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-586s1c1
Sequence:CCGGCCCTAAGGATAAGAACTTAGTCTCGAGACTAAGTTCTTATCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-494s1c1
Sequence:CCGGGCAGTACTTATTATGTTGGATCTCGAGATCCAACATAATAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-584s1c1
Sequence:CCGGGTCCCTAAGGATAAGAACTTACTCGAGTAAGTTCTTATCCTTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016049
VALIDATED
EMC9 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-398s1c1
Sequence:CCGGGCTGGTTACTACCATGCCAATCTCGAGATTGGCATGGTAGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-683s1c1
Sequence:CCGGGACTTTGACTGCCACCTTGATCTCGAGATCAAGGTGGCAGTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-588s1c1
Sequence:CCGGCTAAGGATAAGAACTTAGTGACTCGAGTCACTAAGTTCTTATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-512s1c1
Sequence:CCGGGATAATCAGAAACTGGTGCCTCTCGAGAGGCACCAGTTTCTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-733s1c1
Sequence:CCGGGCTCAACACTCAAATCACCCACTCGAGTGGGTGATTTGAGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-586s1c1
Sequence:CCGGCCCTAAGGATAAGAACTTAGTCTCGAGACTAAGTTCTTATCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-494s1c1
Sequence:CCGGGCAGTACTTATTATGTTGGATCTCGAGATCCAACATAATAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-584s1c1
Sequence:CCGGGTCCCTAAGGATAAGAACTTACTCGAGTAAGTTCTTATCCTTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016049
VALIDATED
EMC9 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-398s1c1
Sequence:CCGGGCTGGTTACTACCATGCCAATCTCGAGATTGGCATGGTAGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-683s1c1
Sequence:CCGGGACTTTGACTGCCACCTTGATCTCGAGATCAAGGTGGCAGTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-588s1c1
Sequence:CCGGCTAAGGATAAGAACTTAGTGACTCGAGTCACTAAGTTCTTATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-512s1c1
Sequence:CCGGGATAATCAGAAACTGGTGCCTCTCGAGAGGCACCAGTTTCTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016049.3-733s1c1
Sequence:CCGGGCTCAACACTCAAATCACCCACTCGAGTGGGTGATTTGAGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-586s1c1
Sequence:CCGGCCCTAAGGATAAGAACTTAGTCTCGAGACTAAGTTCTTATCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-494s1c1
Sequence:CCGGGCAGTACTTATTATGTTGGATCTCGAGATCCAACATAATAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016049.3-584s1c1
Sequence:CCGGGTCCCTAAGGATAAGAACTTACTCGAGTAAGTTCTTATCCTTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033146
VALIDATED
EMC9 MISSION shRNA Bacterial Glycerol Stock
ER membrane protein complex subunit 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-650s1c1
Sequence:CCGGCACCAGCATCTTGTGGACTTTCTCGAGAAAGTCCACAAGATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-476s1c1
Sequence:CCGGGCAGTGCTTATTATGCTGGATCTCGAGATCCAGCATAATAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-571s1c1
Sequence:CCGGCAAGGACAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-518s21c1
Sequence:CCGGCCTCGTGTACCTCCAGTCATTCTCGAGAATGACTGGAGGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-601s21c1
Sequence:CCGGTTGGGAGGAGTCACGACAGATCTCGAGATCTGTCGTGACTCCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-470s21c1
Sequence:CCGGCCCAGGGCAGTGCTTATTATGCTCGAGCATAATAAGCACTGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-444s21c1
Sequence:CCGGTCGCTGGGCGAATTGCAGAATCTCGAGATTCTGCAATTCGCCCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033146.1-387s21c1
Sequence:CCGGACTACCATGCCAATGCGGTTTCTCGAGAAACCGCATTGGCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033146
VALIDATED
EMC9 MISSION shRNA shRNA Plasmid DNA
ER membrane protein complex subunit 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-650s1c1
Sequence:CCGGCACCAGCATCTTGTGGACTTTCTCGAGAAAGTCCACAAGATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-476s1c1
Sequence:CCGGGCAGTGCTTATTATGCTGGATCTCGAGATCCAGCATAATAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-571s1c1
Sequence:CCGGCAAGGACAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-518s21c1
Sequence:CCGGCCTCGTGTACCTCCAGTCATTCTCGAGAATGACTGGAGGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-601s21c1
Sequence:CCGGTTGGGAGGAGTCACGACAGATCTCGAGATCTGTCGTGACTCCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-470s21c1
Sequence:CCGGCCCAGGGCAGTGCTTATTATGCTCGAGCATAATAAGCACTGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-444s21c1
Sequence:CCGGTCGCTGGGCGAATTGCAGAATCTCGAGATTCTGCAATTCGCCCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033146.1-387s21c1
Sequence:CCGGACTACCATGCCAATGCGGTTTCTCGAGAAACCGCATTGGCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033146
VALIDATED
EMC9 MISSION shRNA Lentiviral Transduction Particles
ER membrane protein complex subunit 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-650s1c1
Sequence:CCGGCACCAGCATCTTGTGGACTTTCTCGAGAAAGTCCACAAGATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-476s1c1
Sequence:CCGGGCAGTGCTTATTATGCTGGATCTCGAGATCCAGCATAATAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033146.1-571s1c1
Sequence:CCGGCAAGGACAAGAACTTAGTGATCTCGAGATCACTAAGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-518s21c1
Sequence:CCGGCCTCGTGTACCTCCAGTCATTCTCGAGAATGACTGGAGGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-601s21c1
Sequence:CCGGTTGGGAGGAGTCACGACAGATCTCGAGATCTGTCGTGACTCCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-470s21c1
Sequence:CCGGCCCAGGGCAGTGCTTATTATGCTCGAGCATAATAAGCACTGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033146.1-444s21c1
Sequence:CCGGTCGCTGGGCGAATTGCAGAATCTCGAGATTCTGCAATTCGCCCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033146.1-387s21c1
Sequence:CCGGACTACCATGCCAATGCGGTTTCTCGAGAAACCGCATTGGCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks