EMAIL THIS PAGE TO A FRIEND

EMCN

endomucin

116 Gene Product Result for
Synonyms: EMCN2 MUC14
UniProtKB ID: Q9ULC0, A8K716, B4E347, Q8NEY5, Q8WWE7, Q9NRM8
Gene ID:
Human(51705) Summary: EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]
Mouse(59308) endomucin
Rat(295490) endomucin
sheep(101109178) endomucin
chicken(772178) endomucin
cow(616367) endomucin
dog(609940) endomucin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016242 Rosetta Predictions human pricing
NM_001004228 Rosetta Predictions rat pricing
NM_016885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128281 predicted 523
2 SASI_Hs01_00128282 predicted 804
3 SASI_Hs01_00128283 predicted 690
4 SASI_Hs01_00128284 predicted 361
5 SASI_Hs01_00128287 predicted 690
6 SASI_Hs02_00349116 predicted 434
7 SASI_Hs01_00128288 predicted 832
8 SASI_Hs01_00128289 predicted 926
9 SASI_Hs01_00128290 predicted 695
10 SASI_Hs02_00349117 predicted 271
11 SASI_Hs01_00128285 predicted 441
12 SASI_Hs01_00128286 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071548 predicted 850
2 SASI_Rn01_00071549 predicted 755
3 SASI_Rn01_00071550 predicted 860
4 SASI_Rn02_00198234 predicted 447
5 SASI_Rn01_00071551 predicted 639
6 SASI_Rn01_00071552 predicted 787
7 SASI_Rn01_00071554 predicted 380
8 SASI_Rn01_00071555 predicted 477
9 SASI_Rn01_00071556 predicted 779
10 SASI_Rn01_00071557 predicted 442
11 SASI_Rn01_00071553 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200185 predicted 658
2 SASI_Mm01_00200186 predicted 754
3 SASI_Mm01_00200187 predicted 790
4 SASI_Mm01_00200188 predicted 642
5 SASI_Mm02_00323707 predicted 196
6 SASI_Mm01_00200189 predicted 781
7 SASI_Mm01_00200190 predicted 837
8 SASI_Mm01_00200191 predicted 564
9 SASI_Mm01_00200192 predicted 352
10 SASI_Mm01_00200193 predicted 467
11 SASI_Mm01_00200194 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016242
EMCN MISSION shRNA Bacterial Glycerol Stock
endomucin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-638s21c1
Sequence:CCGGATTAACCTCAATACCAGTTACCTCGAGGTAACTGGTATTGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016242.3-991s21c1
Sequence:CCGGTAGGCAATAATTACGCTTAATCTCGAGATTAAGCGTAATTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-725s21c1
Sequence:CCGGAGCAACCAGCCGGTCTTATTCCTCGAGGAATAAGACCGGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-818s1c1
Sequence:CCGGGCGTGAAGCTTCTTACCGTTACTCGAGTAACGGTAAGAAGCTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-230s1c1
Sequence:CCGGCAACACCAAACACAGAATCATCTCGAGATGATTCTGTGTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-1338s1c1
Sequence:CCGGCCACTATGTTAATGCAGGGAACTCGAGTTCCCTGCATTAACATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-819s1c1
Sequence:CCGGCGTGAAGCTTCTTACCGTTAACTCGAGTTAACGGTAAGAAGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-933s1c1
Sequence:CCGGCGCTTAATCTCCAGCTTCTATCTCGAGATAGAAGCTGGAGATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-403s1c1
Sequence:CCGGGACTCCATCATTTCAAACGTACTCGAGTACGTTTGAAATGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-326s1c1
Sequence:CCGGCTCTGATGTCAACAGCTACTTCTCGAGAAGTAGCTGTTGACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016242
EMCN MISSION shRNA shRNA Plasmid DNA
endomucin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-638s21c1
Sequence:CCGGATTAACCTCAATACCAGTTACCTCGAGGTAACTGGTATTGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016242.3-991s21c1
Sequence:CCGGTAGGCAATAATTACGCTTAATCTCGAGATTAAGCGTAATTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-725s21c1
Sequence:CCGGAGCAACCAGCCGGTCTTATTCCTCGAGGAATAAGACCGGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-818s1c1
Sequence:CCGGGCGTGAAGCTTCTTACCGTTACTCGAGTAACGGTAAGAAGCTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-230s1c1
Sequence:CCGGCAACACCAAACACAGAATCATCTCGAGATGATTCTGTGTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-1338s1c1
Sequence:CCGGCCACTATGTTAATGCAGGGAACTCGAGTTCCCTGCATTAACATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-819s1c1
Sequence:CCGGCGTGAAGCTTCTTACCGTTAACTCGAGTTAACGGTAAGAAGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-933s1c1
Sequence:CCGGCGCTTAATCTCCAGCTTCTATCTCGAGATAGAAGCTGGAGATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-403s1c1
Sequence:CCGGGACTCCATCATTTCAAACGTACTCGAGTACGTTTGAAATGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-326s1c1
Sequence:CCGGCTCTGATGTCAACAGCTACTTCTCGAGAAGTAGCTGTTGACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016242
EMCN MISSION shRNA Lentiviral Transduction Particles
endomucin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-638s21c1
Sequence:CCGGATTAACCTCAATACCAGTTACCTCGAGGTAACTGGTATTGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016242.3-991s21c1
Sequence:CCGGTAGGCAATAATTACGCTTAATCTCGAGATTAAGCGTAATTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016242.3-725s21c1
Sequence:CCGGAGCAACCAGCCGGTCTTATTCCTCGAGGAATAAGACCGGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-818s1c1
Sequence:CCGGGCGTGAAGCTTCTTACCGTTACTCGAGTAACGGTAAGAAGCTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-230s1c1
Sequence:CCGGCAACACCAAACACAGAATCATCTCGAGATGATTCTGTGTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-1338s1c1
Sequence:CCGGCCACTATGTTAATGCAGGGAACTCGAGTTCCCTGCATTAACATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-819s1c1
Sequence:CCGGCGTGAAGCTTCTTACCGTTAACTCGAGTTAACGGTAAGAAGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016242.2-933s1c1
Sequence:CCGGCGCTTAATCTCCAGCTTCTATCTCGAGATAGAAGCTGGAGATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016242.2-403s1c1
Sequence:CCGGGACTCCATCATTTCAAACGTACTCGAGTACGTTTGAAATGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016242.2-326s1c1
Sequence:CCGGCTCTGATGTCAACAGCTACTTCTCGAGAAGTAGCTGTTGACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016885
EMCN MISSION shRNA Bacterial Glycerol Stock
endomucin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-754s1c1
Sequence:CCGGGTCCGATAAAGAGAGTGTGAACTCGAGTTCACACTCTCTTTATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-614s1c1
Sequence:CCGGCCCTCCTATTCCAGTATCATTCTCGAGAATGATACTGGAATAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016885.1-884s1c1
Sequence:CCGGGCTTCATCTTCAGCTTCTAAACTCGAGTTTAGAAGCTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-397s1c1
Sequence:CCGGGAATGAAAGTTCCACTATGAACTCGAGTTCATAGTGGAACTTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016885
EMCN MISSION shRNA shRNA Plasmid DNA
endomucin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-754s1c1
Sequence:CCGGGTCCGATAAAGAGAGTGTGAACTCGAGTTCACACTCTCTTTATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-614s1c1
Sequence:CCGGCCCTCCTATTCCAGTATCATTCTCGAGAATGATACTGGAATAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016885.1-884s1c1
Sequence:CCGGGCTTCATCTTCAGCTTCTAAACTCGAGTTTAGAAGCTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-397s1c1
Sequence:CCGGGAATGAAAGTTCCACTATGAACTCGAGTTCATAGTGGAACTTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016885
EMCN MISSION shRNA Lentiviral Transduction Particles
endomucin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-754s1c1
Sequence:CCGGGTCCGATAAAGAGAGTGTGAACTCGAGTTCACACTCTCTTTATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-614s1c1
Sequence:CCGGCCCTCCTATTCCAGTATCATTCTCGAGAATGATACTGGAATAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016885.1-884s1c1
Sequence:CCGGGCTTCATCTTCAGCTTCTAAACTCGAGTTTAGAAGCTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016885.1-397s1c1
Sequence:CCGGGAATGAAAGTTCCACTATGAACTCGAGTTCATAGTGGAACTTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks