EMAIL THIS PAGE TO A FRIEND

EMD

emerin

75 Gene Product Result for
Synonyms: EDMD LEMD5 STA
UniProtKB ID: P50402, Q6FI02
Gene ID:
Human(2010) Summary: Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]
Mouse(13726) emerin
Rat(25437) emerin
Zebrafish(558212) emerin (Emery-Dreifuss muscular dystrophy)
cow(399681) emerin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000117 Rosetta Predictions human pricing
NM_012948 Rosetta Predictions rat pricing
NM_007927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242518 predicted 318
2 SASI_Hs01_00242519 predicted 223
3 SASI_Hs01_00242521 predicted 406
4 SASI_Hs01_00242522 predicted 452
5 SASI_Hs01_00242523 predicted 588
6 SASI_Hs01_00242525 predicted 531
7 SASI_Hs02_00301902 predicted 324
8 SASI_Hs01_00242526 predicted 321
9 SASI_Hs01_00242527 predicted 292
10 SASI_Hs02_00301903 predicted 283
11 SASI_Hs01_00242520 predicted 558
12 SASI_Hs01_00242524 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068683 predicted 639
2 SASI_Rn01_00068684 predicted 585
3 SASI_Rn01_00068685 predicted 491
4 SASI_Rn01_00068686 predicted 474
5 SASI_Rn01_00068687 predicted 640
6 SASI_Rn02_00260522 predicted 380
7 SASI_Rn01_00068688 predicted 326
8 SASI_Rn01_00068689 predicted 401
9 SASI_Rn01_00068690 predicted 386
10 SASI_Rn01_00068691 predicted 647
11 SASI_Rn01_00068692 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089246 predicted 381
2 SASI_Mm01_00089247 predicted 873
3 SASI_Mm01_00089248 predicted 834
4 SASI_Mm01_00089249 predicted 637
5 SASI_Mm01_00089250 predicted 930
6 SASI_Mm01_00089251 predicted 546
7 SASI_Mm01_00089252 predicted 386
8 SASI_Mm01_00089253 predicted 283
9 SASI_Mm01_00089254 predicted 1054
10 SASI_Mm02_00312762 predicted 1000
11 SASI_Mm01_00089255 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007927
VALIDATED
EMD MISSION shRNA Bacterial Glycerol Stock
emerin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-395s1c1
Sequence:CCGGGACTACTATGAGGAGAGTTATCTCGAGATAACTCTCCTCATAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-374s1c1
Sequence:CCGGCAGAGCAAGGACTATAATGATCTCGAGATCATTATAGTCCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-369s21c1
Sequence:CCGGTACCAGAGCAAGGACTATAATCTCGAGATTATAGTCCTTGCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-639s21c1
Sequence:CCGGAGCTCTCTGGGCTTATCATATCTCGAGATATGATAAGCCCAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.2-641s1c1
Sequence:CCGGCTCTCTGGGCTTATCATATTACTCGAGTAATATGATAAGCCCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007927.2-934s21c1
Sequence:CCGGTGATTGCCTTATCGGTGTTTGCTCGAGCAAACACCGATAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-172s21c1
Sequence:CCGGACATCCCTCATGGGCCTATTGCTCGAGCAATAGGCCCATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-395s21c1
Sequence:CCGGCTACTATGAGGAGAGTTATTTCTCGAGAAATAACTCTCCTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007927
VALIDATED
EMD MISSION shRNA shRNA Plasmid DNA
emerin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-395s1c1
Sequence:CCGGGACTACTATGAGGAGAGTTATCTCGAGATAACTCTCCTCATAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-374s1c1
Sequence:CCGGCAGAGCAAGGACTATAATGATCTCGAGATCATTATAGTCCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-369s21c1
Sequence:CCGGTACCAGAGCAAGGACTATAATCTCGAGATTATAGTCCTTGCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-639s21c1
Sequence:CCGGAGCTCTCTGGGCTTATCATATCTCGAGATATGATAAGCCCAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.2-641s1c1
Sequence:CCGGCTCTCTGGGCTTATCATATTACTCGAGTAATATGATAAGCCCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007927.2-934s21c1
Sequence:CCGGTGATTGCCTTATCGGTGTTTGCTCGAGCAAACACCGATAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-172s21c1
Sequence:CCGGACATCCCTCATGGGCCTATTGCTCGAGCAATAGGCCCATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-395s21c1
Sequence:CCGGCTACTATGAGGAGAGTTATTTCTCGAGAAATAACTCTCCTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007927
VALIDATED
EMD MISSION shRNA Lentiviral Transduction Particles
emerin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-395s1c1
Sequence:CCGGGACTACTATGAGGAGAGTTATCTCGAGATAACTCTCCTCATAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.1-374s1c1
Sequence:CCGGCAGAGCAAGGACTATAATGATCTCGAGATCATTATAGTCCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-369s21c1
Sequence:CCGGTACCAGAGCAAGGACTATAATCTCGAGATTATAGTCCTTGCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-639s21c1
Sequence:CCGGAGCTCTCTGGGCTTATCATATCTCGAGATATGATAAGCCCAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007927.2-641s1c1
Sequence:CCGGCTCTCTGGGCTTATCATATTACTCGAGTAATATGATAAGCCCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007927.2-934s21c1
Sequence:CCGGTGATTGCCTTATCGGTGTTTGCTCGAGCAAACACCGATAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-172s21c1
Sequence:CCGGACATCCCTCATGGGCCTATTGCTCGAGCAATAGGCCCATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007927.2-395s21c1
Sequence:CCGGCTACTATGAGGAGAGTTATTTCTCGAGAAATAACTCTCCTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000117
EMD MISSION shRNA Bacterial Glycerol Stock
emerin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000117.1-1041s1c1
Sequence:CCGGGTTGACATGCATTCCTCCTTTCTCGAGAAAGGAGGAATGCATGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-334s1c1
Sequence:CCGGCGACTACTATGAAGAGAGCTACTCGAGTAGCTCTCTTCATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-456s1c1
Sequence:CCGGAGGTGCATGATGACGATCTTTCTCGAGAAAGATCGTCATCATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-455s1c1
Sequence:CCGGCAGGTGCATGATGACGATCTTCTCGAGAAGATCGTCATCATGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-287s1c1
Sequence:CCGGCCCAAGAAAGAGGACGCTTTACTCGAGTAAAGCGTCCTCTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000117.2-600s21c1
Sequence:CCGGCGCCAGTCAGTGACTTCATTCCTCGAGGAATGAAGTCACTGACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000117.2-1033s21c1
Sequence:CCGGGGCTTCAGAGCTAGGTCTTTGCTCGAGCAAAGACCTAGCTCTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000117
EMD MISSION shRNA shRNA Plasmid DNA
emerin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000117.1-1041s1c1
Sequence:CCGGGTTGACATGCATTCCTCCTTTCTCGAGAAAGGAGGAATGCATGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-334s1c1
Sequence:CCGGCGACTACTATGAAGAGAGCTACTCGAGTAGCTCTCTTCATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-456s1c1
Sequence:CCGGAGGTGCATGATGACGATCTTTCTCGAGAAAGATCGTCATCATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-455s1c1
Sequence:CCGGCAGGTGCATGATGACGATCTTCTCGAGAAGATCGTCATCATGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-287s1c1
Sequence:CCGGCCCAAGAAAGAGGACGCTTTACTCGAGTAAAGCGTCCTCTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000117.2-600s21c1
Sequence:CCGGCGCCAGTCAGTGACTTCATTCCTCGAGGAATGAAGTCACTGACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000117.2-1033s21c1
Sequence:CCGGGGCTTCAGAGCTAGGTCTTTGCTCGAGCAAAGACCTAGCTCTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000117
EMD MISSION shRNA Lentiviral Transduction Particles
emerin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000117.1-1041s1c1
Sequence:CCGGGTTGACATGCATTCCTCCTTTCTCGAGAAAGGAGGAATGCATGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-334s1c1
Sequence:CCGGCGACTACTATGAAGAGAGCTACTCGAGTAGCTCTCTTCATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-456s1c1
Sequence:CCGGAGGTGCATGATGACGATCTTTCTCGAGAAAGATCGTCATCATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-455s1c1
Sequence:CCGGCAGGTGCATGATGACGATCTTCTCGAGAAGATCGTCATCATGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000117.1-287s1c1
Sequence:CCGGCCCAAGAAAGAGGACGCTTTACTCGAGTAAAGCGTCCTCTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000117.2-600s21c1
Sequence:CCGGCGCCAGTCAGTGACTTCATTCCTCGAGGAATGAAGTCACTGACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000117.2-1033s21c1
Sequence:CCGGGGCTTCAGAGCTAGGTCTTTGCTCGAGCAAAGACCTAGCTCTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks