EMAIL THIS PAGE TO A FRIEND

EME2

essential meiotic structure-specific endonuclease subunit 2

Synonyms: SLX2B gs125
UniProtKB ID: A4GXA9, Q8TEP2, Q96RY3
Gene ID:
Human(197342) Summary: EME2 forms a heterodimer with MUS81 (MIM 606591) that functions as an XPF (MIM 278760)-type flap/fork endonuclease in DNA repair (Ciccia et al., 2007 [PubMed 17289582]
Mouse(193838) essential meiotic endonuclease 1 homolog 2 (S. pombe)
Rat(302982) essential meiotic structure-specific endonuclease subunit 2
chicken(416400) essential meiotic endonuclease 1 homolog 2 (S. pombe)
domestic cat(101086279) essential meiotic endonuclease 1 homolog 2 (S. pombe)
cow(515662) essential meiotic structure-specific endonuclease subunit 2
dog(490072) essential meiotic endonuclease 1 homolog 2 (S. pombe)
sheep(101111068) essential meiotic endonuclease 1 homolog 2 (S. pombe)
naked mole-rat(101697749) essential meiotic endonuclease 1 homolog 2 (S. pombe)
domestic guinea pig(100729300) essential meiotic endonuclease 1 homolog 2 (S. pombe)
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496110 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196481 MISSION® esiRNA esiRNA targeting mouse Eme2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010865 Rosetta Predictions human pricing
NM_001129775 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216553 predicted 849
2 SASI_Hs02_00305820 predicted 986
3 SASI_Hs01_00216554 predicted 972
4 SASI_Hs01_00216555 predicted 922
5 SASI_Hs01_00216557 predicted 973
6 SASI_Hs01_00216558 predicted 984
7 SASI_Hs01_00216559 predicted 810
8 SASI_Hs01_00216560 predicted 861
9 SASI_Hs01_00216561 predicted 842
10 SASI_Hs01_00216562 predicted 816
11 SASI_Hs01_00216556 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255199 predicted 1327
2 SASI_Rn02_00255200 predicted 725
3 SASI_Rn02_00255201 predicted 1267
4 SASI_Rn02_00255202 predicted 1035
5 SASI_Rn02_00255203 predicted 1144
6 SASI_Rn02_00255204 predicted 529
7 SASI_Rn02_00255205 predicted 273
8 SASI_Rn02_00255206 predicted 1254
9 SASI_Rn02_00255207 predicted 1072
10 SASI_Rn02_00255208 predicted 1381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496110
EME2 MISSION shRNA Bacterial Glycerol Stock
essential meiotic structure-specific endonuclease subunit 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000049773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496110.1-1338s1c1
Sequence:CCGGCGTGGGACCACCAGGACAGCACTCGAGTGCTGTCCTGGTGGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-572s1c1
Sequence:CCGGTCAGGCTTGCTGTTCTGCAAACTCGAGTTTGCAGAACAGCAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-78s1c1
Sequence:CCGGGCGACCTCCAACCTGGGAGATCTCGAGATCTCCCAGGTTGGAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-1071s1c1
Sequence:CCGGGCGGAGGCAGATCAGGCAGTTCTCGAGAACTGCCTGATCTGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496110
EME2 MISSION shRNA shRNA Plasmid DNA
essential meiotic structure-specific endonuclease subunit 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000049773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496110.1-1338s1c1
Sequence:CCGGCGTGGGACCACCAGGACAGCACTCGAGTGCTGTCCTGGTGGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-572s1c1
Sequence:CCGGTCAGGCTTGCTGTTCTGCAAACTCGAGTTTGCAGAACAGCAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-78s1c1
Sequence:CCGGGCGACCTCCAACCTGGGAGATCTCGAGATCTCCCAGGTTGGAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-1071s1c1
Sequence:CCGGGCGGAGGCAGATCAGGCAGTTCTCGAGAACTGCCTGATCTGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496110
EME2 MISSION shRNA Lentiviral Transduction Particles
essential meiotic structure-specific endonuclease subunit 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000049773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496110.1-1338s1c1
Sequence:CCGGCGTGGGACCACCAGGACAGCACTCGAGTGCTGTCCTGGTGGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-572s1c1
Sequence:CCGGTCAGGCTTGCTGTTCTGCAAACTCGAGTTTGCAGAACAGCAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-78s1c1
Sequence:CCGGGCGACCTCCAACCTGGGAGATCTCGAGATCTCCCAGGTTGGAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496110.1-1071s1c1
Sequence:CCGGGCGGAGGCAGATCAGGCAGTTCTCGAGAACTGCCTGATCTGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks