EMAIL THIS PAGE TO A FRIEND

EMG1

EMG1 N1-specific pseudouridine methyltransferase

52 Gene Product Result for
Synonyms: C2F Grcc2f NEP1
UniProtKB ID: Q92979, O00675, O00726
Gene ID:
Human(10436) Summary: This gene encodes an essential, conserved eukaryotic protein involved in ribosome biogenesis. In yeast, the related protein is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome.[provided by RefSeq, May 2010]
Mouse(14791) EMG1 nucleolar protein homolog (S. cerevisiae)
Rat(312706) EMG1 N1-specific pseudouridine methyltransferase
chicken(418292) EMG1 nucleolar protein homolog (S. cerevisiae)
domestic cat(101088173) EMG1 nucleolar protein homolog (S. cerevisiae)
cow(515362) EMG1 nucleolar protein homolog (S. cerevisiae)
dog(477708) EMG1 nucleolar protein homolog (S. cerevisiae)
domestic guinea pig(100722865) EMG1 N1-specific pseudouridine methyltransferase
naked mole-rat(101726764) EMG1 N1-specific pseudouridine methyltransferase
sheep(101108377) EMG1 nucleolar protein homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006331 Rosetta Predictions human pricing
NM_001107888 Rosetta Predictions rat pricing
NM_013536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073353 predicted 629
2 SASI_Hs02_00341361 predicted 198
3 SASI_Hs01_00073354 predicted 391
4 SASI_Hs01_00073355 predicted 722
5 SASI_Hs01_00073356 predicted 664
6 SASI_Hs01_00073357 predicted 464
7 SASI_Hs02_00341362 predicted 704
8 SASI_Hs01_00073358 predicted 399
9 SASI_Hs01_00073360 predicted 288
10 SASI_Hs02_00341363 predicted 386
11 SASI_Hs01_00073351 predicted 206
12 SASI_Hs01_00073352 predicted 343
13 SASI_Hs01_00073359 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233265 predicted 320
2 SASI_Rn02_00233266 predicted 1332
3 SASI_Rn02_00233267 predicted 1325
4 SASI_Rn02_00233268 predicted 1253
5 SASI_Rn02_00233269 predicted 307
6 SASI_Rn02_00233270 predicted 389
7 SASI_Rn02_00233271 predicted 499
8 SASI_Rn02_00233272 predicted 283
9 SASI_Rn02_00233273 predicted 701
10 SASI_Rn02_00233274 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322235 predicted 538
2 SASI_Mm01_00151589 predicted 388
3 SASI_Mm01_00151591 predicted 536
4 SASI_Mm01_00151592 predicted 460
5 SASI_Mm01_00151594 predicted 380
6 SASI_Mm01_00151595 predicted 241
7 SASI_Mm01_00151596 predicted 583
8 SASI_Mm02_00322236 predicted 265
9 SASI_Mm02_00322237 predicted 282
10 SASI_Mm01_00151598 predicted 453
11 SASI_Mm01_00151590 predicted 289
12 SASI_Mm01_00151593 predicted 706
13 SASI_Mm01_00151597 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006331
VALIDATED
EMG1 MISSION shRNA Bacterial Glycerol Stock
EMG1 N1-specific pseudouridine methyltransferase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-361s1c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-581s1c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006331.4-854s1c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-606s1c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-832s1c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006331.4-844s1c1
Sequence:CCGGGTTCTGAAACCAGAAACTGTTCTCGAGAACAGTTTCTGGTTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006331.4-603s1c1
Sequence:CCGGGATGTATGAAAGTTGGCACTTCTCGAGAAGTGCCAACTTTCATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-410s21c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-655s21c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-903s21c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-881s21c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-630s21c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006331
VALIDATED
EMG1 MISSION shRNA shRNA Plasmid DNA
EMG1 N1-specific pseudouridine methyltransferase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-361s1c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-581s1c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006331.4-854s1c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-606s1c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-832s1c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006331.4-844s1c1
Sequence:CCGGGTTCTGAAACCAGAAACTGTTCTCGAGAACAGTTTCTGGTTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006331.4-603s1c1
Sequence:CCGGGATGTATGAAAGTTGGCACTTCTCGAGAAGTGCCAACTTTCATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-410s21c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-655s21c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-903s21c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-881s21c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-630s21c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006331
VALIDATED
EMG1 MISSION shRNA Lentiviral Transduction Particles
EMG1 N1-specific pseudouridine methyltransferase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-361s1c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-581s1c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006331.4-854s1c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006331.4-606s1c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006331.4-832s1c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006331.4-844s1c1
Sequence:CCGGGTTCTGAAACCAGAAACTGTTCTCGAGAACAGTTTCTGGTTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006331.4-603s1c1
Sequence:CCGGGATGTATGAAAGTTGGCACTTCTCGAGAAGTGCCAACTTTCATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-410s21c1
Sequence:CCGGCCAGAGTTTGCTGATGCTGATCTCGAGATCAGCATCAGCAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-655s21c1
Sequence:CCGGGTATGAAAGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACTTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-903s21c1
Sequence:CCGGCAGAAACTGTTGATGTCACATCTCGAGATGTGACATCAACAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006331.6-881s21c1
Sequence:CCGGGTAGTAGAACCTGTTCTGAAACTCGAGTTTCAGAACAGGTTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006331.6-630s21c1
Sequence:CCGGGTATCAGATCACTTTCCAGTTCTCGAGAACTGGAAAGTGATCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013536
VALIDATED
EMG1 MISSION shRNA Bacterial Glycerol Stock
EMG1 N1-specific pseudouridine methyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-464s1c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-540s1c1
Sequence:CCGGCTCAGAAGCTATTGAAGGTAACTCGAGTTACCTTCAATAGCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-542s1c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-286s1c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-289s1c1
Sequence:CCGGGCACAAGTCCATGTTGTTGAACTCGAGTTCAACAACATGGACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-782s21c1
Sequence:CCGGTGGTGTCCATCAGCAACTATCCTCGAGGATAGTTGCTGATGGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-897s21c1
Sequence:CCGGGGAAGGACTCTTGGCAGTTTGCTCGAGCAAACTGCCAAGAGTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-592s21c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-514s21c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-336s21c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013536
VALIDATED
EMG1 MISSION shRNA shRNA Plasmid DNA
EMG1 N1-specific pseudouridine methyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-464s1c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-540s1c1
Sequence:CCGGCTCAGAAGCTATTGAAGGTAACTCGAGTTACCTTCAATAGCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-542s1c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-286s1c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-289s1c1
Sequence:CCGGGCACAAGTCCATGTTGTTGAACTCGAGTTCAACAACATGGACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-782s21c1
Sequence:CCGGTGGTGTCCATCAGCAACTATCCTCGAGGATAGTTGCTGATGGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-897s21c1
Sequence:CCGGGGAAGGACTCTTGGCAGTTTGCTCGAGCAAACTGCCAAGAGTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-592s21c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-514s21c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-336s21c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013536
VALIDATED
EMG1 MISSION shRNA Lentiviral Transduction Particles
EMG1 N1-specific pseudouridine methyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-464s1c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-540s1c1
Sequence:CCGGCTCAGAAGCTATTGAAGGTAACTCGAGTTACCTTCAATAGCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-542s1c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-286s1c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013536.1-289s1c1
Sequence:CCGGGCACAAGTCCATGTTGTTGAACTCGAGTTCAACAACATGGACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-782s21c1
Sequence:CCGGTGGTGTCCATCAGCAACTATCCTCGAGGATAGTTGCTGATGGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-897s21c1
Sequence:CCGGGGAAGGACTCTTGGCAGTTTGCTCGAGCAAACTGCCAAGAGTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-592s21c1
Sequence:CCGGCAGAAGCTATTGAAGGTAATTCTCGAGAATTACCTTCAATAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-514s21c1
Sequence:CCGGCCTAGAACCTTTGACCGATTTCTCGAGAAATCGGTCAAAGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013536.2-336s21c1
Sequence:CCGGCAGGCACAAGTCCATGTTGTTCTCGAGAACAACATGGACTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks