EMAIL THIS PAGE TO A FRIEND

EMID1

EMI domain containing 1

47 Gene Product Result for
Synonyms: EMI5 EMU1
UniProtKB ID: Q96A84, B0QYK6, Q6ICG1, Q86SS7
Gene ID:
Mouse(140703) EMI domain containing 1
Rat(685462) EMI domain containing 1
sheep(101120697) EMI domain containing 1
naked mole-rat(101726477) EMI domain containing 1
domestic guinea pig(100719175) EMI domain containing 1
Zebrafish(797252) EMI domain containing 1
cow(506282) EMI domain containing 1
domestic cat(101092896) EMI domain containing 1
dog(100687077) EMI domain containing 1
chicken(100859612) EMI domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000592 Anti-EMID1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV50301 Anti-EMID1 antibody produced in rabbit affinity isolated antibody horse, bovine, guinea pig, human, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050721 MISSION® esiRNA esiRNA human EMID1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133455 Rosetta Predictions human pricing
NM_001109467 Rosetta Predictions rat pricing
NM_080595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206225 predicted 1612
2 SASI_Hs01_00206226 predicted 303
3 SASI_Hs01_00206227 predicted 200
4 SASI_Hs01_00206228 predicted 1563
5 SASI_Hs01_00206229 predicted 897
6 SASI_Hs01_00206230 predicted 310
7 SASI_Hs01_00206231 predicted 1658
8 SASI_Hs01_00206232 predicted 1662
9 SASI_Hs01_00206233 predicted 463
10 SASI_Hs02_00363142 predicted 1486
11 SASI_Hs01_00206224 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248687 predicted 521
2 SASI_Rn02_00248688 predicted 330
3 SASI_Rn02_00248689 predicted 1194
4 SASI_Rn02_00248690 predicted 503
5 SASI_Rn02_00248691 predicted 483
6 SASI_Rn02_00248692 predicted 1141
7 SASI_Rn02_00248693 predicted 1197
8 SASI_Rn02_00248694 predicted 1252
9 SASI_Rn02_00248695 predicted 650
10 SASI_Rn02_00248696 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059030 predicted 1440
2 SASI_Mm01_00059031 predicted 1445
3 SASI_Mm01_00059032 predicted 218
4 SASI_Mm02_00338176 predicted 385
5 SASI_Mm01_00059033 predicted 559
6 SASI_Mm01_00059034 predicted 251
7 SASI_Mm01_00059035 predicted 229
8 SASI_Mm01_00059036 predicted 811
9 SASI_Mm01_00059037 predicted 1627
10 SASI_Mm01_00059038 predicted 1276
11 SASI_Mm01_00059039 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133455
VALIDATED
EMID1 MISSION shRNA Bacterial Glycerol Stock
EMI domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-1214s21c1
Sequence:CCGGTACGCGAGGCTTTGAAGATTTCTCGAGAAATCTTCAAAGCCTCGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-309s21c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-201s21c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-542s21c1
Sequence:CCGGTGACCATGCTGACTGTCATAGCTCGAGCTATGACAGTCAGCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133455.2-1651s21c1
Sequence:CCGGCAAGGAGGGATAGAGGTACAACTCGAGTTGTACCTCTATCCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133455.2-1484s1c1
Sequence:CCGGCGCCCGTCCATATTTATTAATCTCGAGATTAATAAATATGGACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-1353s1c1
Sequence:CCGGACATGCAACCAACTACCGGATCTCGAGATCCGGTAGTTGGTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-309s1c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133455.2-1258s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-201s1c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133455
VALIDATED
EMID1 MISSION shRNA shRNA Plasmid DNA
EMI domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-1214s21c1
Sequence:CCGGTACGCGAGGCTTTGAAGATTTCTCGAGAAATCTTCAAAGCCTCGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-309s21c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-201s21c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-542s21c1
Sequence:CCGGTGACCATGCTGACTGTCATAGCTCGAGCTATGACAGTCAGCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133455.2-1651s21c1
Sequence:CCGGCAAGGAGGGATAGAGGTACAACTCGAGTTGTACCTCTATCCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133455.2-1484s1c1
Sequence:CCGGCGCCCGTCCATATTTATTAATCTCGAGATTAATAAATATGGACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-1353s1c1
Sequence:CCGGACATGCAACCAACTACCGGATCTCGAGATCCGGTAGTTGGTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-309s1c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133455.2-1258s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-201s1c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133455
VALIDATED
EMID1 MISSION shRNA Lentiviral Transduction Particles
EMI domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-1214s21c1
Sequence:CCGGTACGCGAGGCTTTGAAGATTTCTCGAGAAATCTTCAAAGCCTCGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-309s21c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-201s21c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133455.2-542s21c1
Sequence:CCGGTGACCATGCTGACTGTCATAGCTCGAGCTATGACAGTCAGCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133455.2-1651s21c1
Sequence:CCGGCAAGGAGGGATAGAGGTACAACTCGAGTTGTACCTCTATCCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133455.2-1484s1c1
Sequence:CCGGCGCCCGTCCATATTTATTAATCTCGAGATTAATAAATATGGACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-1353s1c1
Sequence:CCGGACATGCAACCAACTACCGGATCTCGAGATCCGGTAGTTGGTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-309s1c1
Sequence:CCGGACCCACATACAAGGTGATGTACTCGAGTACATCACCTTGTATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133455.2-1258s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133455.2-201s1c1
Sequence:CCGGCCGCACCATCTCATGCCATGTCTCGAGACATGGCATGAGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080595
EMID1 MISSION shRNA Bacterial Glycerol Stock
EMI domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080595.1-576s1c1
Sequence:CCGGGCAGGATAGACTTGATTCTTGCTCGAGCAAGAATCAAGTCTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-1186s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1460s1c1
Sequence:CCGGCCTATAACATGACAGACTAAACTCGAGTTTAGTCTGTCATGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-243s1c1
Sequence:CCGGCAAAGTGACGTACAAGACAGTCTCGAGACTGTCTTGTACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1389s1c1
Sequence:CCGGGCCAGGTCCTATTTATTAATACTCGAGTATTAATAAATAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-236s1c1
Sequence:CCGGCCTTGTACAAAGTGACGTACACTCGAGTGTACGTCACTTTGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080595
EMID1 MISSION shRNA shRNA Plasmid DNA
EMI domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080595.1-576s1c1
Sequence:CCGGGCAGGATAGACTTGATTCTTGCTCGAGCAAGAATCAAGTCTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-1186s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1460s1c1
Sequence:CCGGCCTATAACATGACAGACTAAACTCGAGTTTAGTCTGTCATGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-243s1c1
Sequence:CCGGCAAAGTGACGTACAAGACAGTCTCGAGACTGTCTTGTACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1389s1c1
Sequence:CCGGGCCAGGTCCTATTTATTAATACTCGAGTATTAATAAATAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-236s1c1
Sequence:CCGGCCTTGTACAAAGTGACGTACACTCGAGTGTACGTCACTTTGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080595
EMID1 MISSION shRNA Lentiviral Transduction Particles
EMI domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080595.1-576s1c1
Sequence:CCGGGCAGGATAGACTTGATTCTTGCTCGAGCAAGAATCAAGTCTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-1186s1c1
Sequence:CCGGGAAACAATGATTGGGCTCTATCTCGAGATAGAGCCCAATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1460s1c1
Sequence:CCGGCCTATAACATGACAGACTAAACTCGAGTTTAGTCTGTCATGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-243s1c1
Sequence:CCGGCAAAGTGACGTACAAGACAGTCTCGAGACTGTCTTGTACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080595.1-1389s1c1
Sequence:CCGGGCCAGGTCCTATTTATTAATACTCGAGTATTAATAAATAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080595.1-236s1c1
Sequence:CCGGCCTTGTACAAAGTGACGTACACTCGAGTGTACGTCACTTTGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks