EMAIL THIS PAGE TO A FRIEND

EMILIN1

elastin microfibril interfacer 1

Synonyms: EMI EMILIN gp115
UniProtKB ID: Q9Y6C2, A5PL03, Q53SY9, Q96G58, Q9UG76
Gene ID:
Human(11117) Summary: This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
Mouse(100952) elastin microfibril interfacer 1
Rat(298845) elastin microfibril interfacer 1
sheep(101113218) elastin microfibril interfacer 1
domestic guinea pig(100718502) elastin microfibril interfacer 1
naked mole-rat(101704860) elastin microfibril interfacer 1
dog(475696) elastin microfibril interfacer 1
Horse(100055491) elastin microfibril interfacer 1
cow(540451) elastin microfibril interfacer 1
domestic cat(101081035) elastin microfibril interfacer 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025111 MISSION® esiRNA esiRNA targeting mouse Emilin1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007046 Rosetta Predictions human pricing
NM_001106710 Rosetta Predictions rat pricing
NM_133918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218611 predicted 1908
2 SASI_Hs02_00342837 predicted 488
3 SASI_Hs01_00218612 predicted 2607
4 SASI_Hs01_00218613 predicted 3099
5 SASI_Hs01_00218614 predicted 2462
6 SASI_Hs01_00218615 predicted 1815
7 SASI_Hs01_00218616 predicted 2087
8 SASI_Hs01_00218617 predicted 802
9 SASI_Hs01_00218618 predicted 647
10 SASI_Hs01_00218619 predicted 2386
11 SASI_Hs01_00218620 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221628 predicted 3294
2 SASI_Rn02_00221629 predicted 1024
3 SASI_Rn02_00221630 predicted 1889
4 SASI_Rn02_00221631 predicted 1993
5 SASI_Rn02_00221632 predicted 3100
6 SASI_Rn02_00221633 predicted 3243
7 SASI_Rn02_00221634 predicted 1244
8 SASI_Rn02_00221635 predicted 2269
9 SASI_Rn02_00221636 predicted 2690
10 SASI_Rn02_00221637 predicted 3500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102855 predicted 2912
2 SASI_Mm01_00102856 predicted 2830
3 SASI_Mm01_00102857 predicted 2879
4 SASI_Mm01_00102858 predicted 944
5 SASI_Mm01_00102859 predicted 370
6 SASI_Mm01_00102860 predicted 2312
7 SASI_Mm01_00102861 predicted 315
8 SASI_Mm01_00102862 predicted 869
9 SASI_Mm01_00102864 predicted 1757
10 SASI_Mm02_00338997 predicted 2013
11 SASI_Mm01_00102863 predicted 1889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007046
EMILIN1 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-1968s1c1
Sequence:CCGGCCTCAATGACTCACTGAATGACTCGAGTCATTCAGTGAGTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2686s1c1
Sequence:CCGGGATGGAGGCTATTATGATCCACTCGAGTGGATCATAATAGCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-699s1c1
Sequence:CCGGGCATGAAACCCTCAATGAGATCTCGAGATCTCATTGAGGGTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1971s1c1
Sequence:CCGGCAATGACTCACTGAATGAGCTCTCGAGAGCTCATTCAGTGAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-217s1c1
Sequence:CCGGGAGGATGGAGTGGAGACATATCTCGAGATATGTCTCCACTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-327s1c1
Sequence:CCGGCTACAAGACAGTGACCGACATCTCGAGATGTCGGTCACTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-83s1c1
Sequence:CCGGGTTTCAGCCTCTACACAGGTTCTCGAGAACCTGTGTAGAGGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2668s1c1
Sequence:CCGGGACAGAGTCCTGCTCAATGATCTCGAGATCATTGAGCAGGACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2038s1c1
Sequence:CCGGGCAACCAAGGACCGTATCATTCTCGAGAATGATACGGTCCTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1941s1c1
Sequence:CCGGCTCTGAGGTTATTCTCAGCTTCTCGAGAAGCTGAGAATAACCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2690s1c1
Sequence:CCGGGAGGCTATTATGATCCAGAGACTCGAGTCTCTGGATCATAATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2047s1c1
Sequence:CCGGGACCGTATCATTTCTGAGATTCTCGAGAATCTCAGAAATGATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007046
EMILIN1 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-1968s1c1
Sequence:CCGGCCTCAATGACTCACTGAATGACTCGAGTCATTCAGTGAGTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2686s1c1
Sequence:CCGGGATGGAGGCTATTATGATCCACTCGAGTGGATCATAATAGCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-699s1c1
Sequence:CCGGGCATGAAACCCTCAATGAGATCTCGAGATCTCATTGAGGGTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1971s1c1
Sequence:CCGGCAATGACTCACTGAATGAGCTCTCGAGAGCTCATTCAGTGAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-217s1c1
Sequence:CCGGGAGGATGGAGTGGAGACATATCTCGAGATATGTCTCCACTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-327s1c1
Sequence:CCGGCTACAAGACAGTGACCGACATCTCGAGATGTCGGTCACTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-83s1c1
Sequence:CCGGGTTTCAGCCTCTACACAGGTTCTCGAGAACCTGTGTAGAGGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2668s1c1
Sequence:CCGGGACAGAGTCCTGCTCAATGATCTCGAGATCATTGAGCAGGACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2038s1c1
Sequence:CCGGGCAACCAAGGACCGTATCATTCTCGAGAATGATACGGTCCTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1941s1c1
Sequence:CCGGCTCTGAGGTTATTCTCAGCTTCTCGAGAAGCTGAGAATAACCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2690s1c1
Sequence:CCGGGAGGCTATTATGATCCAGAGACTCGAGTCTCTGGATCATAATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2047s1c1
Sequence:CCGGGACCGTATCATTTCTGAGATTCTCGAGAATCTCAGAAATGATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007046
EMILIN1 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-1968s1c1
Sequence:CCGGCCTCAATGACTCACTGAATGACTCGAGTCATTCAGTGAGTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2686s1c1
Sequence:CCGGGATGGAGGCTATTATGATCCACTCGAGTGGATCATAATAGCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-699s1c1
Sequence:CCGGGCATGAAACCCTCAATGAGATCTCGAGATCTCATTGAGGGTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1971s1c1
Sequence:CCGGCAATGACTCACTGAATGAGCTCTCGAGAGCTCATTCAGTGAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-217s1c1
Sequence:CCGGGAGGATGGAGTGGAGACATATCTCGAGATATGTCTCCACTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-327s1c1
Sequence:CCGGCTACAAGACAGTGACCGACATCTCGAGATGTCGGTCACTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-83s1c1
Sequence:CCGGGTTTCAGCCTCTACACAGGTTCTCGAGAACCTGTGTAGAGGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-2668s1c1
Sequence:CCGGGACAGAGTCCTGCTCAATGATCTCGAGATCATTGAGCAGGACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2038s1c1
Sequence:CCGGGCAACCAAGGACCGTATCATTCTCGAGAATGATACGGTCCTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007046.1-1941s1c1
Sequence:CCGGCTCTGAGGTTATTCTCAGCTTCTCGAGAAGCTGAGAATAACCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2690s1c1
Sequence:CCGGGAGGCTATTATGATCCAGAGACTCGAGTCTCTGGATCATAATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007046.1-2047s1c1
Sequence:CCGGGACCGTATCATTTCTGAGATTCTCGAGAATCTCAGAAATGATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133918
EMILIN1 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.1-1755s1c1
Sequence:CCGGGAAATCTTACTGCGCCTCAATCTCGAGATTGAGGCGCAGTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2819s21c1
Sequence:CCGGACCACTGGCTGGACGCTATTTCTCGAGAAATAGCGTCCAGCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-1760s21c1
Sequence:CCGGCTTACTGCGCCTCAATCTTACCTCGAGGTAAGATTGAGGCGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-873s21c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133918.2-3245s21c1
Sequence:CCGGCTGCGGTTCAGGCATCCAAATCTCGAGATTTGGATGCCTGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2773s21c1
Sequence:CCGGTCAATGATGGAGGCTACTATGCTCGAGCATAGTAGCCTCCATCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-873s1c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-2026s1c1
Sequence:CCGGGAGAACTCTCTGAGGTTATTCCTCGAGGAATAACCTCAGAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133918
EMILIN1 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.1-1755s1c1
Sequence:CCGGGAAATCTTACTGCGCCTCAATCTCGAGATTGAGGCGCAGTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2819s21c1
Sequence:CCGGACCACTGGCTGGACGCTATTTCTCGAGAAATAGCGTCCAGCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-1760s21c1
Sequence:CCGGCTTACTGCGCCTCAATCTTACCTCGAGGTAAGATTGAGGCGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-873s21c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133918.2-3245s21c1
Sequence:CCGGCTGCGGTTCAGGCATCCAAATCTCGAGATTTGGATGCCTGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2773s21c1
Sequence:CCGGTCAATGATGGAGGCTACTATGCTCGAGCATAGTAGCCTCCATCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-873s1c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-2026s1c1
Sequence:CCGGGAGAACTCTCTGAGGTTATTCCTCGAGGAATAACCTCAGAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133918
EMILIN1 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.1-1755s1c1
Sequence:CCGGGAAATCTTACTGCGCCTCAATCTCGAGATTGAGGCGCAGTAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2819s21c1
Sequence:CCGGACCACTGGCTGGACGCTATTTCTCGAGAAATAGCGTCCAGCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-1760s21c1
Sequence:CCGGCTTACTGCGCCTCAATCTTACCTCGAGGTAAGATTGAGGCGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-873s21c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133918.2-3245s21c1
Sequence:CCGGCTGCGGTTCAGGCATCCAAATCTCGAGATTTGGATGCCTGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133918.2-2773s21c1
Sequence:CCGGTCAATGATGGAGGCTACTATGCTCGAGCATAGTAGCCTCCATCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-873s1c1
Sequence:CCGGCACCTTAACAACCATCATAATCTCGAGATTATGATGGTTGTTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133918.2-2026s1c1
Sequence:CCGGGAGAACTCTCTGAGGTTATTCCTCGAGGAATAACCTCAGAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks