EMAIL THIS PAGE TO A FRIEND

EMILIN2

elastin microfibril interfacer 2

59 Gene Product Result for
Synonyms: EMILIN-2 FOAP-10
UniProtKB ID: Q9BXX0, B2RMY3, Q8NBH3, Q96JQ4
Gene ID:
Mouse(246707) elastin microfibril interfacer 2
Rat(316736) elastin microfibril interfacer 2
chicken(421058) elastin microfibril interfacer 2
dog(100684071) elastin microfibril interfacer 2
Horse(100062096) elastin microfibril interfacer 2
domestic cat(101088438) elastin microfibril interfacer 2
cow(514291) elastin microfibril interfacer 2
naked mole-rat(101714187) elastin microfibril interfacer 2
domestic guinea pig(100717066) elastin microfibril interfacer 2
sheep(101123002) elastin microfibril interfacer 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032048 Rosetta Predictions human pricing
XM_001056498 Rosetta Predictions rat pricing
XM_237520 Rosetta Predictions rat pricing
NM_145158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153265 predicted 1782
2 SASI_Hs01_00153266 predicted 2301
3 SASI_Hs01_00153267 predicted 422
4 SASI_Hs01_00153268 predicted 563
5 SASI_Hs01_00153269 predicted 933
6 SASI_Hs01_00153270 predicted 1928
7 SASI_Hs01_00153271 predicted 435
8 SASI_Hs01_00153272 predicted 3255
9 SASI_Hs01_00153273 predicted 590
10 SASI_Hs01_00153274 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283432 predicted 2306
2 SASI_Rn02_00283433 predicted 2374
3 SASI_Rn02_00283434 predicted 2115
4 SASI_Rn02_00283435 predicted 1003
5 SASI_Rn02_00283436 predicted 2071
6 SASI_Rn02_00283437 predicted 627
7 SASI_Rn02_00283438 predicted 1928
8 SASI_Rn02_00283439 predicted 661
9 SASI_Rn02_00283440 predicted 1061
10 SASI_Rn02_00283441 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390969 predicted 1000
2 SASI_Rn02_00390970 predicted 642
3 SASI_Rn02_00390971 predicted 1452
4 SASI_Rn02_00390972 predicted 1458
5 SASI_Rn02_00390973 predicted 900
6 SASI_Rn02_00390974 predicted 1414
7 SASI_Rn02_00390975 predicted 1307
8 SASI_Rn02_00390976 predicted 1274
9 SASI_Rn02_00390977 predicted 587
10 SASI_Rn02_00390978 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046097 predicted 2009
2 SASI_Mm01_00046098 predicted 644
3 SASI_Mm01_00046099 predicted 362
4 SASI_Mm02_00340588 predicted 2146
5 SASI_Mm01_00046100 predicted 1326
6 SASI_Mm01_00046101 predicted 2284
7 SASI_Mm01_00046102 predicted 2386
8 SASI_Mm01_00046103 predicted 3270
9 SASI_Mm01_00046104 predicted 3007
10 SASI_Mm01_00046105 predicted 1965
11 SASI_Mm01_00046106 predicted 1856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145158
EMILIN2 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145158.3-3508s21c1
Sequence:CCGGGACAACCAGAAGACTCGTTATCTCGAGATAACGAGTCTTCTGGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-2330s21c1
Sequence:CCGGAGATGAACGGGACGCTCAAATCTCGAGATTTGAGCGTCCCGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-255s21c1
Sequence:CCGGGTGCGCCTACATCGTGAATAACTCGAGTTATTCACGATGTAGGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1705s21c1
Sequence:CCGGGAGAATGAGCAGGTCCTAATGCTCGAGCATTAGGACCTGCTCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1475s21c1
Sequence:CCGGAGCTCGACGCAAGGATCAATGCTCGAGCATTGATCCTTGCGTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145158.2-650s1c1
Sequence:CCGGCCTGGTGTATCGGGTAAACTTCTCGAGAAGTTTACCCGATACACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145158
EMILIN2 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145158.3-3508s21c1
Sequence:CCGGGACAACCAGAAGACTCGTTATCTCGAGATAACGAGTCTTCTGGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-2330s21c1
Sequence:CCGGAGATGAACGGGACGCTCAAATCTCGAGATTTGAGCGTCCCGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-255s21c1
Sequence:CCGGGTGCGCCTACATCGTGAATAACTCGAGTTATTCACGATGTAGGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1705s21c1
Sequence:CCGGGAGAATGAGCAGGTCCTAATGCTCGAGCATTAGGACCTGCTCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1475s21c1
Sequence:CCGGAGCTCGACGCAAGGATCAATGCTCGAGCATTGATCCTTGCGTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145158.2-650s1c1
Sequence:CCGGCCTGGTGTATCGGGTAAACTTCTCGAGAAGTTTACCCGATACACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145158
EMILIN2 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145158.3-3508s21c1
Sequence:CCGGGACAACCAGAAGACTCGTTATCTCGAGATAACGAGTCTTCTGGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-2330s21c1
Sequence:CCGGAGATGAACGGGACGCTCAAATCTCGAGATTTGAGCGTCCCGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-255s21c1
Sequence:CCGGGTGCGCCTACATCGTGAATAACTCGAGTTATTCACGATGTAGGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1705s21c1
Sequence:CCGGGAGAATGAGCAGGTCCTAATGCTCGAGCATTAGGACCTGCTCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145158.3-1475s21c1
Sequence:CCGGAGCTCGACGCAAGGATCAATGCTCGAGCATTGATCCTTGCGTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145158.2-650s1c1
Sequence:CCGGCCTGGTGTATCGGGTAAACTTCTCGAGAAGTTTACCCGATACACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032048
VALIDATED
EMILIN2 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-2304s1c1
Sequence:CCGGGCTGGACTCTATCTCAGGAAACTCGAGTTTCCTGAGATAGAGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032048.1-1434s1c1
Sequence:CCGGGCTGAATGGAAGACTGGACAACTCGAGTTGTCCAGTCTTCCATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-411s1c1
Sequence:CCGGGCTGGTGTATCGAGTGAACTTCTCGAGAAGTTCACTCGATACACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3550s1c1
Sequence:CCGGGACAACTGGAAGACTTGGAAACTCGAGTTTCCAAGTCTTCCAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-436s1c1
Sequence:CCGGCCTAGATATGTCACTAGGTATCTCGAGATACCTAGTGACATATCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-1767s1c1
Sequence:CCGGGATGGAATTAAACCACCTGAACTCGAGTTCAGGTGGTTTAATTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-2934s1c1
Sequence:CCGGCTTTAACAAAGTGCTGGTGAACTCGAGTTCACCAGCACTTTGTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032048.1-959s1c1
Sequence:CCGGCTGAAGTCAAAGATACTCTAACTCGAGTTAGAGTATCTTTGACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3718s1c1
Sequence:CCGGGCTGTCTGTCTTTACACTGCACTCGAGTGCAGTGTAAAGACAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032048
VALIDATED
EMILIN2 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-2304s1c1
Sequence:CCGGGCTGGACTCTATCTCAGGAAACTCGAGTTTCCTGAGATAGAGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032048.1-1434s1c1
Sequence:CCGGGCTGAATGGAAGACTGGACAACTCGAGTTGTCCAGTCTTCCATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-411s1c1
Sequence:CCGGGCTGGTGTATCGAGTGAACTTCTCGAGAAGTTCACTCGATACACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3550s1c1
Sequence:CCGGGACAACTGGAAGACTTGGAAACTCGAGTTTCCAAGTCTTCCAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-436s1c1
Sequence:CCGGCCTAGATATGTCACTAGGTATCTCGAGATACCTAGTGACATATCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-1767s1c1
Sequence:CCGGGATGGAATTAAACCACCTGAACTCGAGTTCAGGTGGTTTAATTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-2934s1c1
Sequence:CCGGCTTTAACAAAGTGCTGGTGAACTCGAGTTCACCAGCACTTTGTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032048.1-959s1c1
Sequence:CCGGCTGAAGTCAAAGATACTCTAACTCGAGTTAGAGTATCTTTGACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3718s1c1
Sequence:CCGGGCTGTCTGTCTTTACACTGCACTCGAGTGCAGTGTAAAGACAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032048
VALIDATED
EMILIN2 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-2304s1c1
Sequence:CCGGGCTGGACTCTATCTCAGGAAACTCGAGTTTCCTGAGATAGAGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032048.1-1434s1c1
Sequence:CCGGGCTGAATGGAAGACTGGACAACTCGAGTTGTCCAGTCTTCCATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032048.1-411s1c1
Sequence:CCGGGCTGGTGTATCGAGTGAACTTCTCGAGAAGTTCACTCGATACACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3550s1c1
Sequence:CCGGGACAACTGGAAGACTTGGAAACTCGAGTTTCCAAGTCTTCCAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-436s1c1
Sequence:CCGGCCTAGATATGTCACTAGGTATCTCGAGATACCTAGTGACATATCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-1767s1c1
Sequence:CCGGGATGGAATTAAACCACCTGAACTCGAGTTCAGGTGGTTTAATTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032048.1-2934s1c1
Sequence:CCGGCTTTAACAAAGTGCTGGTGAACTCGAGTTCACCAGCACTTTGTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032048.1-959s1c1
Sequence:CCGGCTGAAGTCAAAGATACTCTAACTCGAGTTAGAGTATCTTTGACTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032048.1-3718s1c1
Sequence:CCGGGCTGTCTGTCTTTACACTGCACTCGAGTGCAGTGTAAAGACAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)