EMAIL THIS PAGE TO A FRIEND

EMILIN3

elastin microfibril interfacer 3

43 Gene Product Result for
Synonyms: C20orf130 EMILIN5 dJ620E11.4
UniProtKB ID: Q9NT22, Q495S6, Q495S7, Q76KT4
Gene ID:
Mouse(280635) elastin microfibril interfacer 3
Rat(362262) elastin microfibril interfacer 3
chicken(428137) elastin microfibril interfacer 3
dog(485877) elastin microfibril interfacer 3
cow(788927) elastin microfibril interfacer 3
domestic cat(101092428) elastin microfibril interfacer 3
sheep(101104083) elastin microfibril interfacer 3
domestic guinea pig(100718103) elastin microfibril interfacer 3
naked mole-rat(101721655) elastin microfibril interfacer 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150041 MISSION® esiRNA esiRNA human EMILIN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052846 Rosetta Predictions human pricing
NM_001109901 Rosetta Predictions rat pricing
NM_182840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185834 predicted 2780
2 SASI_Hs01_00185835 predicted 533
3 SASI_Hs01_00185836 predicted 2861
4 SASI_Hs01_00185837 predicted 2713
5 SASI_Hs01_00185838 predicted 515
6 SASI_Hs01_00185839 predicted 517
7 SASI_Hs01_00185840 predicted 2781
8 SASI_Hs01_00185841 predicted 1379
9 SASI_Hs01_00185842 predicted 999
10 SASI_Hs01_00185843 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250832 predicted 1627
2 SASI_Rn02_00250833 predicted 315
3 SASI_Rn02_00250834 predicted 1246
4 SASI_Rn02_00250835 predicted 447
5 SASI_Rn02_00250836 predicted 937
6 SASI_Rn02_00250837 predicted 362
7 SASI_Rn02_00250838 predicted 714
8 SASI_Rn02_00250839 predicted 461
9 SASI_Rn02_00250840 predicted 1890
10 SASI_Rn02_00250841 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036145 predicted 2483
2 SASI_Mm01_00036146 predicted 2475
3 SASI_Mm01_00036147 predicted 1617
4 SASI_Mm01_00036148 predicted 1988
5 SASI_Mm01_00036149 predicted 447
6 SASI_Mm01_00036150 predicted 762
7 SASI_Mm01_00036151 predicted 1435
8 SASI_Mm01_00036152 predicted 1891
9 SASI_Mm01_00036153 predicted 379
10 SASI_Mm01_00036154 predicted 2530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052846
VALIDATED
EMILIN3 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-799s1c1
Sequence:CCGGGCCTGGCTCAAACATATGGTACTCGAGTACCATATGTTTGAGCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052846.1-961s1c1
Sequence:CCGGCTCCCTTAGACGAGATCCTAACTCGAGTTAGGATCTCGTCTAAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-2042s1c1
Sequence:CCGGCCAGTACTCTGATGCCTTCTTCTCGAGAAGAAGGCATCAGAGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-3589s1c1
Sequence:CCGGCCATCAATGGACAACTTGAAACTCGAGTTTCAAGTTGTCCATTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-520s1c1
Sequence:CCGGGCACAGTACTCAGACCCAAATCTCGAGATTTGGGTCTGAGTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2622s21c1
Sequence:CCGGGCTAGCCCAAATGGCACTAAGCTCGAGCTTAGTGCCATTTGGGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2767s21c1
Sequence:CCGGGACTTGAGAGAGTTCACATTCCTCGAGGAATGTGAACTCTCTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-1381s21c1
Sequence:CCGGGGCAACTAGCCTTGATCAATGCTCGAGCATTGATCAAGGCTAGTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-452s21c1
Sequence:CCGGGAGCTACGTAAAGGCTGAATACTCGAGTATTCAGCCTTTACGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052846
VALIDATED
EMILIN3 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-799s1c1
Sequence:CCGGGCCTGGCTCAAACATATGGTACTCGAGTACCATATGTTTGAGCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052846.1-961s1c1
Sequence:CCGGCTCCCTTAGACGAGATCCTAACTCGAGTTAGGATCTCGTCTAAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-2042s1c1
Sequence:CCGGCCAGTACTCTGATGCCTTCTTCTCGAGAAGAAGGCATCAGAGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-3589s1c1
Sequence:CCGGCCATCAATGGACAACTTGAAACTCGAGTTTCAAGTTGTCCATTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-520s1c1
Sequence:CCGGGCACAGTACTCAGACCCAAATCTCGAGATTTGGGTCTGAGTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2622s21c1
Sequence:CCGGGCTAGCCCAAATGGCACTAAGCTCGAGCTTAGTGCCATTTGGGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2767s21c1
Sequence:CCGGGACTTGAGAGAGTTCACATTCCTCGAGGAATGTGAACTCTCTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-1381s21c1
Sequence:CCGGGGCAACTAGCCTTGATCAATGCTCGAGCATTGATCAAGGCTAGTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-452s21c1
Sequence:CCGGGAGCTACGTAAAGGCTGAATACTCGAGTATTCAGCCTTTACGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052846
VALIDATED
EMILIN3 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-799s1c1
Sequence:CCGGGCCTGGCTCAAACATATGGTACTCGAGTACCATATGTTTGAGCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052846.1-961s1c1
Sequence:CCGGCTCCCTTAGACGAGATCCTAACTCGAGTTAGGATCTCGTCTAAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-2042s1c1
Sequence:CCGGCCAGTACTCTGATGCCTTCTTCTCGAGAAGAAGGCATCAGAGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-3589s1c1
Sequence:CCGGCCATCAATGGACAACTTGAAACTCGAGTTTCAAGTTGTCCATTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052846.1-520s1c1
Sequence:CCGGGCACAGTACTCAGACCCAAATCTCGAGATTTGGGTCTGAGTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2622s21c1
Sequence:CCGGGCTAGCCCAAATGGCACTAAGCTCGAGCTTAGTGCCATTTGGGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052846.1-2767s21c1
Sequence:CCGGGACTTGAGAGAGTTCACATTCCTCGAGGAATGTGAACTCTCTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-1381s21c1
Sequence:CCGGGGCAACTAGCCTTGATCAATGCTCGAGCATTGATCAAGGCTAGTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052846.1-452s21c1
Sequence:CCGGGAGCTACGTAAAGGCTGAATACTCGAGTATTCAGCCTTTACGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182840
EMILIN3 MISSION shRNA Bacterial Glycerol Stock
elastin microfibril interfacer 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-373s21c1
Sequence:CCGGAGGAGCAGAGAGCTATATAAACTCGAGTTTATATAGCTCTCTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182840.1-3009s21c1
Sequence:CCGGAGCCAAGAGCGCTCCATATTCCTCGAGGAATATGGAGCGCTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-1654s21c1
Sequence:CCGGACTAGCAGTACTGGAACAAAGCTCGAGCTTTGTTCCAGTACTGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-332s21c1
Sequence:CCGGGCCTATGTGGTACACAGAAATCTCGAGATTTCTGTGTACCACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-459s21c1
Sequence:CCGGTCAGACCCAGATACAAGATTGCTCGAGCAATCTTGTATCTGGGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182840
EMILIN3 MISSION shRNA shRNA Plasmid DNA
elastin microfibril interfacer 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-373s21c1
Sequence:CCGGAGGAGCAGAGAGCTATATAAACTCGAGTTTATATAGCTCTCTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182840.1-3009s21c1
Sequence:CCGGAGCCAAGAGCGCTCCATATTCCTCGAGGAATATGGAGCGCTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-1654s21c1
Sequence:CCGGACTAGCAGTACTGGAACAAAGCTCGAGCTTTGTTCCAGTACTGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-332s21c1
Sequence:CCGGGCCTATGTGGTACACAGAAATCTCGAGATTTCTGTGTACCACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-459s21c1
Sequence:CCGGTCAGACCCAGATACAAGATTGCTCGAGCAATCTTGTATCTGGGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182840
EMILIN3 MISSION shRNA Lentiviral Transduction Particles
elastin microfibril interfacer 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-373s21c1
Sequence:CCGGAGGAGCAGAGAGCTATATAAACTCGAGTTTATATAGCTCTCTGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182840.1-3009s21c1
Sequence:CCGGAGCCAAGAGCGCTCCATATTCCTCGAGGAATATGGAGCGCTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-1654s21c1
Sequence:CCGGACTAGCAGTACTGGAACAAAGCTCGAGCTTTGTTCCAGTACTGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-332s21c1
Sequence:CCGGGCCTATGTGGTACACAGAAATCTCGAGATTTCTGTGTACCACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182840.1-459s21c1
Sequence:CCGGTCAGACCCAGATACAAGATTGCTCGAGCAATCTTGTATCTGGGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)