EMAIL THIS PAGE TO A FRIEND

EML1

echinoderm microtubule associated protein like 1

222 Gene Product Result for
Synonyms: ELP79 EMAP EMAPL HuEMAP
UniProtKB ID: O00423, Q86U15, Q8N536, Q8N5C4, Q8WWL6
Gene ID:
Human(2009) Summary: Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68519) echinoderm microtubule associated protein like 1
Rat(362783) echinoderm microtubule associated protein like 1
Zebrafish(767643) echinoderm microtubule associated protein like 1
chicken(423452) echinoderm microtubule associated protein like 1
dog(490853) echinoderm microtubule associated protein like 1
domestic cat(101091632) echinoderm microtubule associated protein like 1
Horse(100050910) echinoderm microtubule associated protein like 1
cow(512904) echinoderm microtubule associated protein like 1
naked mole-rat(101707759) echinoderm microtubule associated protein like 1
domestic guinea pig(100730040) echinoderm microtubule associated protein like 1
sheep(101117881) echinoderm microtubule associated protein like 1
Domestic Rabbit(100352985) echinoderm microtubule associated protein like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008707 Rosetta Predictions human pricing
NM_004434 Rosetta Predictions human pricing
NM_001025741 Rosetta Predictions rat pricing
XM_001069752 Rosetta Predictions rat pricing
NM_001043335 Rosetta Predictions mouse pricing
NM_001043336 Rosetta Predictions mouse pricing
XM_001002730 Rosetta Predictions mouse pricing
XM_127139 Rosetta Predictions mouse pricing
XM_901759 Rosetta Predictions mouse pricing
XM_901766 Rosetta Predictions mouse pricing
XM_901773 Rosetta Predictions mouse pricing
XM_901775 Rosetta Predictions mouse pricing
XM_901779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122358 predicted 1025
2 SASI_Hs02_00305536 predicted 915
3 SASI_Hs01_00122359 predicted 1413
4 SASI_Hs01_00122360 predicted 756
5 SASI_Hs01_00122361 predicted 2052
6 SASI_Hs01_00122362 predicted 2260
7 SASI_Hs01_00122363 predicted 1236
8 SASI_Hs01_00122364 predicted 1215
9 SASI_Hs01_00122365 predicted 1423
10 SASI_Hs01_00122367 predicted 828
11 SASI_Hs01_00122366 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133469 predicted 972
2 SASI_Hs02_00337606 predicted 853
3 SASI_Hs01_00133470 predicted 1355
4 SASI_Hs01_00133471 predicted 706
5 SASI_Hs01_00133472 predicted 1993
6 SASI_Hs01_00133473 predicted 2203
7 SASI_Hs01_00133474 predicted 1186
8 SASI_Hs01_00133475 predicted 1157
9 SASI_Hs01_00133476 predicted 1367
10 SASI_Hs01_00133478 predicted 768
11 SASI_Hs01_00133477 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104968 predicted 1859
2 SASI_Rn01_00104969 predicted 1329
3 SASI_Rn02_00203382 predicted 1432
4 SASI_Rn01_00104970 predicted 313
5 SASI_Rn01_00104971 predicted 1231
6 SASI_Rn01_00104972 predicted 829
7 SASI_Rn01_00104973 predicted 1236
8 SASI_Rn01_00104974 predicted 2319
9 SASI_Rn01_00104975 predicted 1235
10 SASI_Rn01_00104977 predicted 1929
11 SASI_Rn01_00104976 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329152 predicted 379
2 SASI_Rn02_00329153 predicted 465
3 SASI_Rn02_00329154 predicted 379
4 SASI_Rn02_00329155 predicted 317
5 SASI_Rn02_00329156 predicted 388
6 SASI_Rn02_00329157 predicted 313
7 SASI_Rn02_00329158 predicted 480
8 SASI_Rn02_00329159 predicted 314
9 SASI_Rn02_00329160 predicted 380
10 SASI_Rn02_00329161 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291175 predicted 1621
2 SASI_Mm02_00291176 predicted 1275
3 SASI_Mm02_00291177 predicted 915
4 SASI_Mm02_00291178 predicted 2271
5 SASI_Mm02_00291179 predicted 1666
6 SASI_Mm02_00291180 predicted 1566
7 SASI_Mm02_00291181 predicted 1162
8 SASI_Mm02_00291182 predicted 653
9 SASI_Mm02_00291183 predicted 1925
10 SASI_Mm02_00291184 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291185 predicted 1218
2 SASI_Mm02_00291186 predicted 870
3 SASI_Mm02_00291187 predicted 509
4 SASI_Mm02_00291188 predicted 1859
5 SASI_Mm02_00291189 predicted 1263
6 SASI_Mm02_00291190 predicted 1167
7 SASI_Mm02_00291191 predicted 763
8 SASI_Mm02_00291192 predicted 248
9 SASI_Mm02_00291193 predicted 1520
10 SASI_Mm02_00291194 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249476 predicted 1634
2 SASI_Mm01_00249477 predicted 925
3 SASI_Mm01_00249478 predicted 1665
4 SASI_Mm01_00249479 predicted 1576
5 SASI_Mm01_00249480 predicted 1171
6 SASI_Mm01_00249481 predicted 651
7 SASI_Mm01_00249482 predicted 1924
8 SASI_Mm01_00249483 predicted 2662
9 SASI_Mm01_00249484 predicted 1723
10 SASI_Mm01_00249485 predicted 2619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278046 predicted 1340
2 SASI_Mm01_00278047 predicted 626
3 SASI_Mm01_00278048 predicted 1376
4 SASI_Mm01_00278049 predicted 1279
5 SASI_Mm01_00278050 predicted 875
6 SASI_Mm01_00278051 predicted 359
7 SASI_Mm01_00278052 predicted 1639
8 SASI_Mm01_00278053 predicted 2364
9 SASI_Mm01_00278054 predicted 1436
10 SASI_Mm01_00278055 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213066 predicted 925
2 SASI_Mm01_00213067 predicted 1041
3 SASI_Mm01_00213068 predicted 915
4 SASI_Mm01_00213069 predicted 1058
5 SASI_Mm01_00213070 predicted 605
6 SASI_Mm01_00213071 predicted 693
7 SASI_Mm01_00213072 predicted 1197
8 SASI_Mm01_00213073 predicted 483
9 SASI_Mm01_00213074 predicted 601
10 SASI_Mm01_00213075 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264939 predicted 1169
2 SASI_Mm01_00264940 predicted 398
3 SASI_Mm01_00264941 predicted 455
4 SASI_Mm01_00264942 predicted 820
5 SASI_Mm01_00264943 predicted 1206
6 SASI_Mm01_00264944 predicted 1111
7 SASI_Mm01_00264945 predicted 712
8 SASI_Mm01_00264946 predicted 1509
9 SASI_Mm01_00264947 predicted 2241
10 SASI_Mm01_00264948 predicted 2206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241332 predicted 1624
2 SASI_Mm01_00241333 predicted 922
3 SASI_Mm01_00241334 predicted 1666
4 SASI_Mm01_00241335 predicted 1574
5 SASI_Mm01_00241336 predicted 1168
6 SASI_Mm01_00241337 predicted 655
7 SASI_Mm01_00241338 predicted 1923
8 SASI_Mm01_00241339 predicted 2656
9 SASI_Mm01_00241340 predicted 1722
10 SASI_Mm01_00241341 predicted 2625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234354 predicted 1578
2 SASI_Mm01_00234355 predicted 868
3 SASI_Mm01_00234356 predicted 1621
4 SASI_Mm01_00234357 predicted 1526
5 SASI_Mm01_00234358 predicted 1121
6 SASI_Mm01_00234359 predicted 606
7 SASI_Mm01_00234360 predicted 1874
8 SASI_Mm01_00234361 predicted 2611
9 SASI_Mm01_00234362 predicted 1681
10 SASI_Mm01_00234363 predicted 2571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210237 predicted 1634
2 SASI_Mm01_00210238 predicted 925
3 SASI_Mm01_00210239 predicted 1675
4 SASI_Mm01_00210240 predicted 1571
5 SASI_Mm01_00210241 predicted 1172
6 SASI_Mm01_00210242 predicted 656
7 SASI_Mm01_00210243 predicted 1932
8 SASI_Mm01_00210244 predicted 2664
9 SASI_Mm01_00210245 predicted 1725
10 SASI_Mm01_00210246 predicted 2626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004434
VALIDATED
EML1 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004434.2-2495s21c1
Sequence:CCGGTCATGCAGTGGCGCGTCATTTCTCGAGAAATGACGCGCCACTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1162s21c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-3279s21c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1567s21c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-818s21c1
Sequence:CCGGTCGCATCCGTGGTGGTGTTATCTCGAGATAACACCACCACGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004434.2-3279s1c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1567s1c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-671s1c1
Sequence:CCGGCCAAAGATCAAGTGGATTCTTCTCGAGAAGAATCCACTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004434.2-2015s1c1
Sequence:CCGGGCATCTATATATATGGCGTTACTCGAGTAACGCCATATATATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1162s1c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004434
VALIDATED
EML1 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004434.2-2495s21c1
Sequence:CCGGTCATGCAGTGGCGCGTCATTTCTCGAGAAATGACGCGCCACTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1162s21c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-3279s21c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1567s21c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-818s21c1
Sequence:CCGGTCGCATCCGTGGTGGTGTTATCTCGAGATAACACCACCACGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004434.2-3279s1c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1567s1c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-671s1c1
Sequence:CCGGCCAAAGATCAAGTGGATTCTTCTCGAGAAGAATCCACTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004434.2-2015s1c1
Sequence:CCGGGCATCTATATATATGGCGTTACTCGAGTAACGCCATATATATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1162s1c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004434
VALIDATED
EML1 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004434.2-2495s21c1
Sequence:CCGGTCATGCAGTGGCGCGTCATTTCTCGAGAAATGACGCGCCACTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1162s21c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-3279s21c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-1567s21c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_004434.2-818s21c1
Sequence:CCGGTCGCATCCGTGGTGGTGTTATCTCGAGATAACACCACCACGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004434.2-3279s1c1
Sequence:CCGGGCCACCTTCTTGTGTATATTACTCGAGTAATATACACAAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1567s1c1
Sequence:CCGGCCAGAACAGTTTGGTCCAATACTCGAGTATTGGACCAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-671s1c1
Sequence:CCGGCCAAAGATCAAGTGGATTCTTCTCGAGAAGAATCCACTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004434.2-2015s1c1
Sequence:CCGGGCATCTATATATATGGCGTTACTCGAGTAACGCCATATATATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004434.2-1162s1c1
Sequence:CCGGGCAGATGTGAAGTGCTCTAATCTCGAGATTAGAGCACTTCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127139
EML1 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127139.7-3515s1c1
Sequence:CCGGCGGATCTTTAAATAGAGGAATCTCGAGATTCCTCTATTTAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-602s1c1
Sequence:CCGGCCAAGTGGATTCGTACAGTTTCTCGAGAAACTGTACGAATCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1189s1c1
Sequence:CCGGCCCTAGAAGGAAATTCCCTTACTCGAGTAAGGGAATTTCCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1939s1c1
Sequence:CCGGGCATCTACATATATGGAGTTACTCGAGTAACTCCATATATGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127139
EML1 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127139.7-3515s1c1
Sequence:CCGGCGGATCTTTAAATAGAGGAATCTCGAGATTCCTCTATTTAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-602s1c1
Sequence:CCGGCCAAGTGGATTCGTACAGTTTCTCGAGAAACTGTACGAATCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1189s1c1
Sequence:CCGGCCCTAGAAGGAAATTCCCTTACTCGAGTAAGGGAATTTCCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1939s1c1
Sequence:CCGGGCATCTACATATATGGAGTTACTCGAGTAACTCCATATATGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127139
EML1 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127139.7-3515s1c1
Sequence:CCGGCGGATCTTTAAATAGAGGAATCTCGAGATTCCTCTATTTAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-602s1c1
Sequence:CCGGCCAAGTGGATTCGTACAGTTTCTCGAGAAACTGTACGAATCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1189s1c1
Sequence:CCGGCCCTAGAAGGAAATTCCCTTACTCGAGTAAGGGAATTTCCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127139.7-1939s1c1
Sequence:CCGGGCATCTACATATATGGAGTTACTCGAGTAACTCCATATATGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks