EMAIL THIS PAGE TO A FRIEND

EML2

echinoderm microtubule associated protein like 2

148 Gene Product Result for
Synonyms: ELP70 EMAP-2 EMAP2
Gene ID:
Mouse(72205) echinoderm microtubule associated protein like 2
Rat(192360) echinoderm microtubule associated protein like 2
sheep(101117612) echinoderm microtubule associated protein like 2
domestic guinea pig(100722962) echinoderm microtubule associated protein like 2
naked mole-rat(101707203) echinoderm microtubule associated protein like 2
Zebrafish(569375) echinoderm microtubule associated protein like 2
dog(476434) echinoderm microtubule associated protein like 2
cow(512380) echinoderm microtubule associated protein like 2
domestic cat(101094309) echinoderm microtubule associated protein like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_133217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012155 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012155 Rosetta Predictions human pricing
NM_138921 Rosetta Predictions rat pricing
XM_001480295 Rosetta Predictions mouse pricing
XM_133217 Rosetta Predictions mouse pricing
XM_895759 Rosetta Predictions mouse pricing
XM_895770 Rosetta Predictions mouse pricing
XM_895785 Rosetta Predictions mouse pricing
XM_905228 Rosetta Predictions mouse pricing
XM_919217 Rosetta Predictions mouse pricing
XM_919238 Rosetta Predictions mouse pricing
XM_919253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216403 predicted 1698
2 SASI_Hs01_00216404 predicted 330
3 SASI_Hs01_00216405 predicted 344
4 SASI_Hs01_00216406 predicted 1229
5 SASI_Hs01_00216407 predicted 1772
6 SASI_Hs01_00216408 predicted 1414
7 SASI_Hs01_00216409 predicted 686
8 SASI_Hs01_00216410 predicted 1229
9 SASI_Hs01_00216411 predicted 693
10 SASI_Hs01_00216412 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035905 predicted 1064
2 SASI_Rn01_00035906 predicted 2054
3 SASI_Rn01_00035907 predicted 2048
4 SASI_Rn01_00035908 predicted 1349
5 SASI_Rn01_00035909 predicted 2143
6 SASI_Rn01_00035910 predicted 769
7 SASI_Rn02_00268406 predicted 1719
8 SASI_Rn01_00035911 predicted 820
9 SASI_Rn01_00035913 predicted 942
10 SASI_Rn01_00035914 predicted 637
11 SASI_Rn01_00035912 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416493 predicted 657
2 SASI_Mm02_00416494 predicted 784
3 SASI_Mm02_00416495 predicted 635
4 SASI_Mm02_00416496 predicted 1412
5 SASI_Mm02_00416497 predicted 1205
6 SASI_Mm02_00416498 predicted 480
7 SASI_Mm02_00416499 predicted 671
8 SASI_Mm02_00416500 predicted 1434
9 SASI_Mm02_00416501 predicted 722
10 SASI_Mm02_00416502 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214756 predicted 642
2 SASI_Mm01_00214757 predicted 760
3 SASI_Mm01_00214758 predicted 614
4 SASI_Mm01_00214759 predicted 1385
5 SASI_Mm01_00214760 predicted 1182
6 SASI_Mm01_00214761 predicted 462
7 SASI_Mm01_00214762 predicted 651
8 SASI_Mm01_00214763 predicted 1410
9 SASI_Mm01_00214764 predicted 706
10 SASI_Mm01_00214765 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204013 predicted 807
2 SASI_Mm01_00204014 predicted 931
3 SASI_Mm01_00204015 predicted 779
4 SASI_Mm01_00204016 predicted 1558
5 SASI_Mm01_00204017 predicted 1347
6 SASI_Mm01_00204018 predicted 624
7 SASI_Mm01_00204019 predicted 816
8 SASI_Mm01_00204020 predicted 1579
9 SASI_Mm01_00204021 predicted 875
10 SASI_Mm01_00204022 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225022 predicted 1372
2 SASI_Mm01_00225023 predicted 1496
3 SASI_Mm01_00225024 predicted 1349
4 SASI_Mm01_00225025 predicted 2122
5 SASI_Mm01_00225026 predicted 1922
6 SASI_Mm01_00225027 predicted 1191
7 SASI_Mm01_00225028 predicted 1384
8 SASI_Mm01_00225029 predicted 2142
9 SASI_Mm01_00225030 predicted 1434
10 SASI_Mm01_00225031 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238977 predicted 1338
2 SASI_Mm01_00238978 predicted 1454
3 SASI_Mm01_00238979 predicted 1307
4 SASI_Mm01_00238980 predicted 2084
5 SASI_Mm01_00238981 predicted 1878
6 SASI_Mm01_00238982 predicted 1156
7 SASI_Mm01_00238983 predicted 1346
8 SASI_Mm01_00238984 predicted 2103
9 SASI_Mm01_00238985 predicted 1394
10 SASI_Mm01_00238986 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431594 predicted 1394
2 SASI_Mm02_00431595 predicted 1195
3 SASI_Mm02_00431596 predicted 1798
4 SASI_Mm02_00431597 predicted 364
5 SASI_Mm02_00431598 predicted 1919
6 SASI_Mm02_00431599 predicted 1413
7 SASI_Mm02_00431600 predicted 902
8 SASI_Mm02_00431601 predicted 1782
9 SASI_Mm02_00431602 predicted 1422
10 SASI_Mm02_00431603 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442228 predicted 793
2 SASI_Mm02_00442229 predicted 727
3 SASI_Mm02_00442230 predicted 2089
4 SASI_Mm02_00442231 predicted 1884
5 SASI_Mm02_00442232 predicted 856
6 SASI_Mm02_00442233 predicted 2616
7 SASI_Mm02_00442234 predicted 2116
8 SASI_Mm02_00442235 predicted 1598
9 SASI_Mm02_00442236 predicted 2474
10 SASI_Mm02_00442237 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442238 predicted 1370
2 SASI_Mm02_00442239 predicted 1161
3 SASI_Mm02_00442240 predicted 1585
4 SASI_Mm02_00442241 predicted 1770
5 SASI_Mm02_00442242 predicted 1893
6 SASI_Mm02_00442243 predicted 1395
7 SASI_Mm02_00442244 predicted 871
8 SASI_Mm02_00442245 predicted 1753
9 SASI_Mm02_00442246 predicted 1395
10 SASI_Mm02_00442247 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442258 predicted 766
2 SASI_Mm02_00442259 predicted 707
3 SASI_Mm02_00442260 predicted 2070
4 SASI_Mm02_00442261 predicted 1870
5 SASI_Mm02_00442262 predicted 834
6 SASI_Mm02_00442263 predicted 2592
7 SASI_Mm02_00442264 predicted 2095
8 SASI_Mm02_00442265 predicted 1578
9 SASI_Mm02_00442266 predicted 2454
10 SASI_Mm02_00442267 predicted 2103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133217
EML2 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133217.6-2118s1c1
Sequence:CCGGCAGTAATATATACCCAGAGTACTCGAGTACTCTGGGTATATATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-197s1c1
Sequence:CCGGCTAAAGCTAGACTGGGTGTATCTCGAGATACACCCAGTCTAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1948s1c1
Sequence:CCGGCCATGTGACTAATGTGGCCTTCTCGAGAAGGCCACATTAGTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1451s1c1
Sequence:CCGGGCTATCCACACAGATGGCAATCTCGAGATTGCCATCTGTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-823s1c1
Sequence:CCGGCCTGTTCGAGAAACACGAGAACTCGAGTTCTCGTGTTTCTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133217
EML2 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133217.6-2118s1c1
Sequence:CCGGCAGTAATATATACCCAGAGTACTCGAGTACTCTGGGTATATATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-197s1c1
Sequence:CCGGCTAAAGCTAGACTGGGTGTATCTCGAGATACACCCAGTCTAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1948s1c1
Sequence:CCGGCCATGTGACTAATGTGGCCTTCTCGAGAAGGCCACATTAGTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1451s1c1
Sequence:CCGGGCTATCCACACAGATGGCAATCTCGAGATTGCCATCTGTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-823s1c1
Sequence:CCGGCCTGTTCGAGAAACACGAGAACTCGAGTTCTCGTGTTTCTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133217
EML2 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133217.6-2118s1c1
Sequence:CCGGCAGTAATATATACCCAGAGTACTCGAGTACTCTGGGTATATATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-197s1c1
Sequence:CCGGCTAAAGCTAGACTGGGTGTATCTCGAGATACACCCAGTCTAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1948s1c1
Sequence:CCGGCCATGTGACTAATGTGGCCTTCTCGAGAAGGCCACATTAGTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-1451s1c1
Sequence:CCGGGCTATCCACACAGATGGCAATCTCGAGATTGCCATCTGTGTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133217.6-823s1c1
Sequence:CCGGCCTGTTCGAGAAACACGAGAACTCGAGTTCTCGTGTTTCTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012155
VALIDATED
EML2 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1475s1c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1698s1c1
Sequence:CCGGGCTACTTGTGTCCTAGGGTTTCTCGAGAAACCCTAGGACACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012155.1-2113s1c1
Sequence:CCGGCTGACATACAGAAGTCTCTATCTCGAGATAGAGACTTCTGTATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012155.1-343s1c1
Sequence:CCGGGACACAACGATGACATCAAATCTCGAGATTTGATGTCATCGTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-528s21c1
Sequence:CCGGGTGGGCTTCTCCAAATCTAATCTCGAGATTAGATTTGGAGAAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1226s21c1
Sequence:CCGGGGATAAGCTGGTGCATCTATGCTCGAGCATAGATGCACCAGCTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-2043s21c1
Sequence:CCGGTTGCCGAGTAGAGTAATATATCTCGAGATATATTACTCTACTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1475s21c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-695s21c1
Sequence:CCGGGCTTATCACCTGCGGGAAATCCTCGAGGATTTCCCGCAGGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012155
VALIDATED
EML2 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1475s1c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1698s1c1
Sequence:CCGGGCTACTTGTGTCCTAGGGTTTCTCGAGAAACCCTAGGACACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012155.1-2113s1c1
Sequence:CCGGCTGACATACAGAAGTCTCTATCTCGAGATAGAGACTTCTGTATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012155.1-343s1c1
Sequence:CCGGGACACAACGATGACATCAAATCTCGAGATTTGATGTCATCGTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-528s21c1
Sequence:CCGGGTGGGCTTCTCCAAATCTAATCTCGAGATTAGATTTGGAGAAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1226s21c1
Sequence:CCGGGGATAAGCTGGTGCATCTATGCTCGAGCATAGATGCACCAGCTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-2043s21c1
Sequence:CCGGTTGCCGAGTAGAGTAATATATCTCGAGATATATTACTCTACTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1475s21c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-695s21c1
Sequence:CCGGGCTTATCACCTGCGGGAAATCCTCGAGGATTTCCCGCAGGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012155
VALIDATED
EML2 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1475s1c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012155.1-1698s1c1
Sequence:CCGGGCTACTTGTGTCCTAGGGTTTCTCGAGAAACCCTAGGACACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012155.1-2113s1c1
Sequence:CCGGCTGACATACAGAAGTCTCTATCTCGAGATAGAGACTTCTGTATGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012155.1-343s1c1
Sequence:CCGGGACACAACGATGACATCAAATCTCGAGATTTGATGTCATCGTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-528s21c1
Sequence:CCGGGTGGGCTTCTCCAAATCTAATCTCGAGATTAGATTTGGAGAAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1226s21c1
Sequence:CCGGGGATAAGCTGGTGCATCTATGCTCGAGCATAGATGCACCAGCTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-2043s21c1
Sequence:CCGGTTGCCGAGTAGAGTAATATATCTCGAGATATATTACTCTACTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012155.1-1475s21c1
Sequence:CCGGCGACAACTTGGTGTACGTGTACTCGAGTACACGTACACCAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012155.1-695s21c1
Sequence:CCGGGCTTATCACCTGCGGGAAATCCTCGAGGATTTCCCGCAGGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks