EMAIL THIS PAGE TO A FRIEND

EML3

echinoderm microtubule associated protein like 3

40 Gene Product Result for
Synonyms: ELP95
UniProtKB ID: Q32P44, Q6ZQW7, Q8NA55
Gene ID:
Mouse(225898) echinoderm microtubule associated protein like 3
Rat(293723) echinoderm microtubule associated protein like 3
Zebrafish(100533983) echinoderm microtubule associated protein like 3
cow(504884) echinoderm microtubule associated protein like 3
domestic cat(101088519) echinoderm microtubule associated protein like 3
dog(483787) echinoderm microtubule associated protein like 3
naked mole-rat(101718584) echinoderm microtubule associated protein like 3
domestic guinea pig(100732472) echinoderm microtubule associated protein like 3
sheep(101111136) echinoderm microtubule associated protein like 3
Domestic Rabbit(100350786) echinoderm microtubule associated protein like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303258 ANTI-EMAL3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2100681 Anti-EML3 antibody produced in rabbit affinity isolated antibody bovine, canine, rabbit, rat, human, mouse, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010541 MISSION® esiRNA esiRNA targeting mouse Eml3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153265 Rosetta Predictions human pricing
XM_215147 Rosetta Predictions rat pricing
NM_144872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013371 predicted 1683
2 SASI_Hs01_00013372 predicted 1338
3 SASI_Hs01_00013373 predicted 2252
4 SASI_Hs02_00367144 predicted 1422
5 SASI_Hs01_00013374 predicted 836
6 SASI_Hs01_00013375 predicted 1801
7 SASI_Hs01_00013376 predicted 1844
8 SASI_Hs01_00013377 predicted 2583
9 SASI_Hs01_00013379 predicted 2415
10 SASI_Hs01_00013380 predicted 1597
11 SASI_Hs01_00013378 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124432 predicted 2539
2 SASI_Rn01_00124433 predicted 2317
3 SASI_Rn01_00124434 predicted 429
4 SASI_Rn01_00124435 predicted 2273
5 SASI_Rn01_00124436 predicted 2005
6 SASI_Rn01_00124437 predicted 2369
7 SASI_Rn01_00124438 predicted 1166
8 SASI_Rn01_00124439 predicted 1317
9 SASI_Rn01_00124440 predicted 2029
10 SASI_Rn01_00124441 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037802 predicted 692
2 SASI_Mm01_00037803 predicted 770
3 SASI_Mm01_00037804 predicted 1979
4 SASI_Mm01_00037805 predicted 2799
5 SASI_Mm01_00037806 predicted 1610
6 SASI_Mm01_00037807 predicted 2242
7 SASI_Mm01_00037808 predicted 1511
8 SASI_Mm01_00037809 predicted 2325
9 SASI_Mm01_00037810 predicted 2349
10 SASI_Mm01_00037811 predicted 2447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153265
VALIDATED
EML3 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-2320s21c1
Sequence:CCGGAGATCGTGTCTGATGTCATTGCTCGAGCAATGACATCAGACACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-914s21c1
Sequence:CCGGTGGATCTCGGAGGAGCAATTACTCGAGTAATTGCTCCTCCGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1503s21c1
Sequence:CCGGGCTGAGATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1568s21c1
Sequence:CCGGCATCGTCACCAGTGGGAAATCCTCGAGGATTTCCCACTGGTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2084s1c1
Sequence:CCGGGACAACGTGATCTACATCTATCTCGAGATAGATGTAGATCACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-765s1c1
Sequence:CCGGCCCGCTCTAATCTGTTTGTGTCTCGAGACACAAACAGATTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2085s1c1
Sequence:CCGGACAACGTGATCTACATCTATACTCGAGTATAGATGTAGATCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-724s1c1
Sequence:CCGGCCTCAGCCTTGACTGGGTTTACTCGAGTAAACCCAGTCAAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-1481s1c1
Sequence:CCGGGCCAAAGAGACCTATGGGATTCTCGAGAATCCCATAGGTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153265
VALIDATED
EML3 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-2320s21c1
Sequence:CCGGAGATCGTGTCTGATGTCATTGCTCGAGCAATGACATCAGACACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-914s21c1
Sequence:CCGGTGGATCTCGGAGGAGCAATTACTCGAGTAATTGCTCCTCCGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1503s21c1
Sequence:CCGGGCTGAGATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1568s21c1
Sequence:CCGGCATCGTCACCAGTGGGAAATCCTCGAGGATTTCCCACTGGTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2084s1c1
Sequence:CCGGGACAACGTGATCTACATCTATCTCGAGATAGATGTAGATCACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-765s1c1
Sequence:CCGGCCCGCTCTAATCTGTTTGTGTCTCGAGACACAAACAGATTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2085s1c1
Sequence:CCGGACAACGTGATCTACATCTATACTCGAGTATAGATGTAGATCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-724s1c1
Sequence:CCGGCCTCAGCCTTGACTGGGTTTACTCGAGTAAACCCAGTCAAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-1481s1c1
Sequence:CCGGGCCAAAGAGACCTATGGGATTCTCGAGAATCCCATAGGTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153265
VALIDATED
EML3 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-2320s21c1
Sequence:CCGGAGATCGTGTCTGATGTCATTGCTCGAGCAATGACATCAGACACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-914s21c1
Sequence:CCGGTGGATCTCGGAGGAGCAATTACTCGAGTAATTGCTCCTCCGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1503s21c1
Sequence:CCGGGCTGAGATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153265.2-1568s21c1
Sequence:CCGGCATCGTCACCAGTGGGAAATCCTCGAGGATTTCCCACTGGTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2084s1c1
Sequence:CCGGGACAACGTGATCTACATCTATCTCGAGATAGATGTAGATCACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-765s1c1
Sequence:CCGGCCCGCTCTAATCTGTTTGTGTCTCGAGACACAAACAGATTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-2085s1c1
Sequence:CCGGACAACGTGATCTACATCTATACTCGAGTATAGATGTAGATCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-724s1c1
Sequence:CCGGCCTCAGCCTTGACTGGGTTTACTCGAGTAAACCCAGTCAAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153265.1-1481s1c1
Sequence:CCGGGCCAAAGAGACCTATGGGATTCTCGAGAATCCCATAGGTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144872
VALIDATED
EML3 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2790s21c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2341s21c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144872.1-3034s21c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-1435s21c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-3034s1c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-1435s1c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-2790s1c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-1060s1c1
Sequence:CCGGGTCTACTTTATTGCCTGTGTACTCGAGTACACAGGCAATAAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-2341s1c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144872
VALIDATED
EML3 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2790s21c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2341s21c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144872.1-3034s21c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-1435s21c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-3034s1c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-1435s1c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-2790s1c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-1060s1c1
Sequence:CCGGGTCTACTTTATTGCCTGTGTACTCGAGTACACAGGCAATAAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-2341s1c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144872
VALIDATED
EML3 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2790s21c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-2341s21c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144872.1-3034s21c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144872.1-1435s21c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-3034s1c1
Sequence:CCGGTGACTTCATACATTCCCAATTCTCGAGAATTGGGAATGTATGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-1435s1c1
Sequence:CCGGGCTGAGATTAAGAGTACAAATCTCGAGATTTGTACTCTTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144872.1-2790s1c1
Sequence:CCGGCGACTCATACCTTGTCTCCTTCTCGAGAAGGAGACAAGGTATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-1060s1c1
Sequence:CCGGGTCTACTTTATTGCCTGTGTACTCGAGTACACAGGCAATAAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144872.1-2341s1c1
Sequence:CCGGGACAACATGATCTACATCTATCTCGAGATAGATGTAGATCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks