EMAIL THIS PAGE TO A FRIEND

EML4

echinoderm microtubule associated protein like 4

140 Gene Product Result for
Synonyms: C2orf2 ELP120 EMAP-4 EMAPL4 ROPP120
Gene ID:
Mouse(78798) echinoderm microtubule associated protein like 4
Rat(313861) echinoderm microtubule associated protein like 4
sheep(101115950) echinoderm microtubule associated protein like 4
Domestic Rabbit(100352828) echinoderm microtubule associated protein like 4
domestic guinea pig(100723938) echinoderm microtubule associated protein like 4
naked mole-rat(101715651) echinoderm microtubule associated protein like 4
chicken(771345) echinoderm microtubule associated protein like 4
domestic cat(101094586) echinoderm microtubule associated protein like 4
cow(540187) echinoderm microtubule associated protein like 4
Horse(100053784) echinoderm microtubule associated protein like 4
dog(483048) echinoderm microtubule associated protein like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017951 MISSION® esiRNA esiRNA targeting human EML4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019063 Rosetta Predictions human pricing
NM_001108008 Rosetta Predictions rat pricing
NM_001114361 Rosetta Predictions mouse pricing
NM_001114362 Rosetta Predictions mouse pricing
NM_199466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087838 predicted 2947
2 SASI_Hs01_00087840 predicted 2442
3 SASI_Hs02_00352649 predicted 2224
4 SASI_Hs02_00352650 predicted 2899
5 SASI_Hs02_00352651 predicted 1383
6 SASI_Hs02_00352652 predicted 1009
7 SASI_Hs01_00087841 predicted 918
8 SASI_Hs01_00087844 predicted 1023
9 SASI_Hs02_00352653 predicted 822
10 SASI_Hs01_00087845 predicted 1279
11 SASI_Hs01_00087839 predicted 2226
12 SASI_Hs01_00087842 predicted 2763
13 SASI_Hs01_00087843 predicted 1495
14 SASI_Hs01_00087846 predicted 2540
15 SASI_Hs01_00087847 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234455 predicted 695
2 SASI_Rn02_00234456 predicted 2019
3 SASI_Rn02_00234457 predicted 262
4 SASI_Rn02_00234458 predicted 2258
5 SASI_Rn02_00234459 predicted 2393
6 SASI_Rn02_00234460 predicted 365
7 SASI_Rn02_00234461 predicted 618
8 SASI_Rn02_00234462 predicted 2123
9 SASI_Rn02_00234463 predicted 1459
10 SASI_Rn02_00234464 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308580 predicted 1797
2 SASI_Mm02_00308581 predicted 340
3 SASI_Mm02_00308582 predicted 1269
4 SASI_Mm02_00308583 predicted 2547
5 SASI_Mm02_00308584 predicted 1921
6 SASI_Mm02_00308585 predicted 2298
7 SASI_Mm02_00308586 predicted 1450
8 SASI_Mm02_00308587 predicted 2397
9 SASI_Mm02_00308588 predicted 1825
10 SASI_Mm02_00308589 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308590 predicted 1582
2 SASI_Mm02_00308591 predicted 334
3 SASI_Mm02_00308592 predicted 1062
4 SASI_Mm02_00308593 predicted 2337
5 SASI_Mm02_00308594 predicted 1708
6 SASI_Mm02_00308595 predicted 2094
7 SASI_Mm02_00308596 predicted 1244
8 SASI_Mm02_00308597 predicted 2188
9 SASI_Mm02_00308598 predicted 1623
10 SASI_Mm02_00308599 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034376 predicted 1457
2 SASI_Mm02_00351471 predicted 333
3 SASI_Mm01_00034377 predicted 932
4 SASI_Mm01_00034378 predicted 2210
5 SASI_Mm02_00351472 predicted 1586
6 SASI_Mm01_00034379 predicted 1969
7 SASI_Mm02_00351473 predicted 1122
8 SASI_Mm01_00034381 predicted 2052
9 SASI_Mm01_00034382 predicted 1493
10 SASI_Mm01_00034384 predicted 1543
11 SASI_Mm01_00034380 predicted 707
12 SASI_Mm01_00034383 predicted 1147
13 SASI_Mm01_00034385 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199466
VALIDATED
EML4 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199466.1-3838s1c1
Sequence:CCGGGCCTAAACATTCTGTAATGTTCTCGAGAACATTACAGAATGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2702s1c1
Sequence:CCGGCCTAATTTCAACTGGTGGGAACTCGAGTTCCCACCAGTTGAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-1024s1c1
Sequence:CCGGCCTCAGTGGTAGTCCTGTTTACTCGAGTAAACAGGACTACCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2435s1c1
Sequence:CCGGCCGATCAGATTGCAAGGACATCTCGAGATGTCCTTGCAATCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-879s1c1
Sequence:CCGGCCTTCGGATGTTGACAACTATCTCGAGATAGTTGTCAACATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-964s21c1
Sequence:CCGGAGATAGCCGGAGTAGACAAAGCTCGAGCTTTGTCTACTCCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2171s21c1
Sequence:CCGGCCCAGACAATAAGCATATAATCTCGAGATTATATGCTTATTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-625s21c1
Sequence:CCGGATAAAGATGTCATCGTCAATCCTCGAGGATTGACGATGACATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3146s21c1
Sequence:CCGGGTGTCCAAGAAATCCACATTTCTCGAGAAATGTGGATTTCTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3032s21c1
Sequence:CCGCACACTGTCCGCAGTCCGATATCTCGAGATATCGGACTGCGGACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-1110s21c1
Sequence:CCGGGGTGTTCATTTATGCGTTATTCTCGAGAATAACGCATAAATGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2391s21c1
Sequence:CCGGATCGCAGTGGCCGATGATTTCCTCGAGGAAATCATCGGCCACTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-532s21c1
Sequence:CCGGTAACCAATGGAAGTGGTATAACTCGAGTTATACCACTTCCATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199466
VALIDATED
EML4 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199466.1-3838s1c1
Sequence:CCGGGCCTAAACATTCTGTAATGTTCTCGAGAACATTACAGAATGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2702s1c1
Sequence:CCGGCCTAATTTCAACTGGTGGGAACTCGAGTTCCCACCAGTTGAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-1024s1c1
Sequence:CCGGCCTCAGTGGTAGTCCTGTTTACTCGAGTAAACAGGACTACCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2435s1c1
Sequence:CCGGCCGATCAGATTGCAAGGACATCTCGAGATGTCCTTGCAATCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-879s1c1
Sequence:CCGGCCTTCGGATGTTGACAACTATCTCGAGATAGTTGTCAACATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-964s21c1
Sequence:CCGGAGATAGCCGGAGTAGACAAAGCTCGAGCTTTGTCTACTCCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2171s21c1
Sequence:CCGGCCCAGACAATAAGCATATAATCTCGAGATTATATGCTTATTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-625s21c1
Sequence:CCGGATAAAGATGTCATCGTCAATCCTCGAGGATTGACGATGACATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3146s21c1
Sequence:CCGGGTGTCCAAGAAATCCACATTTCTCGAGAAATGTGGATTTCTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3032s21c1
Sequence:CCGCACACTGTCCGCAGTCCGATATCTCGAGATATCGGACTGCGGACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-1110s21c1
Sequence:CCGGGGTGTTCATTTATGCGTTATTCTCGAGAATAACGCATAAATGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2391s21c1
Sequence:CCGGATCGCAGTGGCCGATGATTTCCTCGAGGAAATCATCGGCCACTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-532s21c1
Sequence:CCGGTAACCAATGGAAGTGGTATAACTCGAGTTATACCACTTCCATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199466
VALIDATED
EML4 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199466.1-3838s1c1
Sequence:CCGGGCCTAAACATTCTGTAATGTTCTCGAGAACATTACAGAATGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2702s1c1
Sequence:CCGGCCTAATTTCAACTGGTGGGAACTCGAGTTCCCACCAGTTGAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-1024s1c1
Sequence:CCGGCCTCAGTGGTAGTCCTGTTTACTCGAGTAAACAGGACTACCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-2435s1c1
Sequence:CCGGCCGATCAGATTGCAAGGACATCTCGAGATGTCCTTGCAATCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199466.1-879s1c1
Sequence:CCGGCCTTCGGATGTTGACAACTATCTCGAGATAGTTGTCAACATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-964s21c1
Sequence:CCGGAGATAGCCGGAGTAGACAAAGCTCGAGCTTTGTCTACTCCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2171s21c1
Sequence:CCGGCCCAGACAATAAGCATATAATCTCGAGATTATATGCTTATTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-625s21c1
Sequence:CCGGATAAAGATGTCATCGTCAATCCTCGAGGATTGACGATGACATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3146s21c1
Sequence:CCGGGTGTCCAAGAAATCCACATTTCTCGAGAAATGTGGATTTCTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199466.3-3032s21c1
Sequence:CCGCACACTGTCCGCAGTCCGATATCTCGAGATATCGGACTGCGGACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-1110s21c1
Sequence:CCGGGGTGTTCATTTATGCGTTATTCTCGAGAATAACGCATAAATGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-2391s21c1
Sequence:CCGGATCGCAGTGGCCGATGATTTCCTCGAGGAAATCATCGGCCACTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199466.3-532s21c1
Sequence:CCGGTAACCAATGGAAGTGGTATAACTCGAGTTATACCACTTCCATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019063
VALIDATED
EML4 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-5005s1c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1552s1c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-2518s1c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1553s1c1
Sequence:CCGGCGGCAATTCACTAACAAGAAACTCGAGTTTCTTGTTAGTGAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019063.2-936s1c1
Sequence:CCGGCGGCCAATTACCATGTTCATTCTCGAGAATGAACATGGTAATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1578s21c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-2544s21c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-5031s21c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1128s21c1
Sequence:CCGGCATCAGTAGTAGTACTATTTACTCGAGTAAATAGTACTACTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-824s21c1
Sequence:CCGGTCAGATGATAGCCGTAATAAACTCGAGTTTATTACGGCTATCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019063
VALIDATED
EML4 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-5005s1c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1552s1c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-2518s1c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1553s1c1
Sequence:CCGGCGGCAATTCACTAACAAGAAACTCGAGTTTCTTGTTAGTGAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019063.2-936s1c1
Sequence:CCGGCGGCCAATTACCATGTTCATTCTCGAGAATGAACATGGTAATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1578s21c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-2544s21c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-5031s21c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1128s21c1
Sequence:CCGGCATCAGTAGTAGTACTATTTACTCGAGTAAATAGTACTACTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-824s21c1
Sequence:CCGGTCAGATGATAGCCGTAATAAACTCGAGTTTATTACGGCTATCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019063
VALIDATED
EML4 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-5005s1c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1552s1c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-2518s1c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019063.2-1553s1c1
Sequence:CCGGCGGCAATTCACTAACAAGAAACTCGAGTTTCTTGTTAGTGAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019063.2-936s1c1
Sequence:CCGGCGGCCAATTACCATGTTCATTCTCGAGAATGAACATGGTAATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1578s21c1
Sequence:CCGGGCGGCAATTCACTAACAAGAACTCGAGTTCTTGTTAGTGAATTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-2544s21c1
Sequence:CCGGCGGATTGTAAGGACATTGATTCTCGAGAATCAATGTCCTTACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-5031s21c1
Sequence:CCGGCGCCAGTAAGTATCAGGCATACTCGAGTATGCCTGATACTTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019063.3-1128s21c1
Sequence:CCGGCATCAGTAGTAGTACTATTTACTCGAGTAAATAGTACTACTACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_019063.3-824s21c1
Sequence:CCGGTCAGATGATAGCCGTAATAAACTCGAGTTTATTACGGCTATCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks