EMAIL THIS PAGE TO A FRIEND

EML5

echinoderm microtubule associated protein like 5

131 Gene Product Result for
Synonyms: EMAP-2
UniProtKB ID: Q05BV3, B9EK59, Q5H9N6, Q6UYC9, Q6ZRP3, Q6ZT03
Gene ID:
Mouse(319670) echinoderm microtubule associated protein like 5
Rat(444982) echinoderm microtubule associated protein like 5
chicken(423400) echinoderm microtubule associated protein like 5
domestic cat(101084633) echinoderm microtubule associated protein like 5
cow(537305) echinoderm microtubule associated protein like 5
Horse(100052869) echinoderm microtubule associated protein like 5
dog(490824) echinoderm microtubule associated protein like 5
naked mole-rat(101712661) echinoderm microtubule associated protein like 5
domestic guinea pig(100732854) echinoderm microtubule associated protein like 5
sheep(101114197) echinoderm microtubule associated protein like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183387 Rosetta Predictions human pricing
XM_001064022 Rosetta Predictions rat pricing
XM_001064054 Rosetta Predictions rat pricing
XM_001064078 Rosetta Predictions rat pricing
NM_001081191 Rosetta Predictions mouse pricing
XM_001000550 Rosetta Predictions mouse pricing
XM_001000580 Rosetta Predictions mouse pricing
XM_286452 Rosetta Predictions mouse pricing
XM_901317 Rosetta Predictions mouse pricing
XM_901325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085423 predicted 3960
2 SASI_Hs02_00371296 predicted 608
3 SASI_Hs02_00371297 predicted 4945
4 SASI_Hs01_00085424 predicted 503
5 SASI_Hs01_00085425 predicted 1930
6 SASI_Hs01_00085426 predicted 2239
7 SASI_Hs01_00085428 predicted 3062
8 SASI_Hs01_00085429 predicted 3882
9 SASI_Hs01_00085430 predicted 3812
10 SASI_Hs01_00085432 predicted 2501
11 SASI_Hs01_00085427 predicted 5883
12 SASI_Hs01_00085431 predicted 4918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309065 predicted 1085
2 SASI_Rn02_00309066 predicted 1214
3 SASI_Rn02_00309067 predicted 1968
4 SASI_Rn02_00309068 predicted 1445
5 SASI_Rn02_00309069 predicted 2936
6 SASI_Rn02_00309070 predicted 3287
7 SASI_Rn02_00309071 predicted 3314
8 SASI_Rn02_00309072 predicted 1772
9 SASI_Rn02_00309073 predicted 2018
10 SASI_Rn02_00309074 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309176 predicted 1002
2 SASI_Rn02_00309177 predicted 3443
3 SASI_Rn02_00309178 predicted 3384
4 SASI_Rn02_00309179 predicted 2889
5 SASI_Rn02_00309180 predicted 1331
6 SASI_Rn02_00309181 predicted 4743
7 SASI_Rn02_00309182 predicted 1435
8 SASI_Rn02_00309183 predicted 5045
9 SASI_Rn02_00309184 predicted 5397
10 SASI_Rn02_00309185 predicted 5647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309252 predicted 1080
2 SASI_Rn02_00309253 predicted 1212
3 SASI_Rn02_00309254 predicted 1444
4 SASI_Rn02_00309255 predicted 2935
5 SASI_Rn02_00309256 predicted 3874
6 SASI_Rn02_00309257 predicted 3820
7 SASI_Rn02_00309258 predicted 4340
8 SASI_Rn02_00309259 predicted 3316
9 SASI_Rn02_00309260 predicted 1771
10 SASI_Rn02_00309261 predicted 2015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296081 predicted 2505
2 SASI_Mm02_00296082 predicted 3973
3 SASI_Mm02_00296083 predicted 3827
4 SASI_Mm02_00296084 predicted 2028
5 SASI_Mm02_00296085 predicted 3882
6 SASI_Mm02_00296086 predicted 6466
7 SASI_Mm02_00296087 predicted 3331
8 SASI_Mm02_00296088 predicted 2596
9 SASI_Mm02_00296089 predicted 5186
10 SASI_Mm02_00296090 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253270 predicted 1463
2 SASI_Mm01_00253271 predicted 1844
3 SASI_Mm01_00253272 predicted 1243
4 SASI_Mm01_00253273 predicted 1965
5 SASI_Mm01_00253274 predicted 1365
6 SASI_Mm01_00253275 predicted 1685
7 SASI_Mm01_00253276 predicted 1692
8 SASI_Mm01_00253277 predicted 1905
9 SASI_Mm01_00253278 predicted 1904
10 SASI_Mm01_00253279 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278308 predicted 510
2 SASI_Mm01_00278309 predicted 885
3 SASI_Mm01_00278310 predicted 1110
4 SASI_Mm01_00278311 predicted 956
5 SASI_Mm01_00278312 predicted 1012
6 SASI_Mm01_00278313 predicted 1788
7 SASI_Mm01_00278314 predicted 3602
8 SASI_Mm01_00278315 predicted 2293
9 SASI_Mm01_00278316 predicted 461
10 SASI_Mm01_00278317 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_286452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226832 predicted 2517
2 SASI_Mm01_00226833 predicted 3979
3 SASI_Mm01_00226834 predicted 3832
4 SASI_Mm01_00226835 predicted 2036
5 SASI_Mm01_00226836 predicted 3895
6 SASI_Mm01_00226837 predicted 2477
7 SASI_Mm01_00226838 predicted 6474
8 SASI_Mm01_00226839 predicted 3331
9 SASI_Mm01_00226840 predicted 2604
10 SASI_Mm01_00226841 predicted 5194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278123 predicted 2196
2 SASI_Mm01_00278124 predicted 2582
3 SASI_Mm01_00278125 predicted 1982
4 SASI_Mm01_00278126 predicted 2704
5 SASI_Mm01_00278127 predicted 2095
6 SASI_Mm01_00278128 predicted 2417
7 SASI_Mm01_00278129 predicted 2430
8 SASI_Mm01_00278130 predicted 1717
9 SASI_Mm01_00278131 predicted 1894
10 SASI_Mm01_00278132 predicted 2642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263539 predicted 1439
2 SASI_Mm01_00263540 predicted 837
3 SASI_Mm01_00263541 predicted 1556
4 SASI_Mm01_00263542 predicted 958
5 SASI_Mm01_00263543 predicted 278
6 SASI_Mm01_00263544 predicted 1271
7 SASI_Mm01_00263545 predicted 1290
8 SASI_Mm01_00263546 predicted 581
9 SASI_Mm01_00263547 predicted 746
10 SASI_Mm01_00263548 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183387
EML5 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183387.1-6285s21c1
Sequence:CCGGGCTATATGCACTGGGTATAATCTCGAGATTATACCCAGTGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-1904s21c1
Sequence:CCGGATGATTATCAGTGGGTTATTTCTCGAGAAATAACCCACTGATAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-2245s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-3080s21c1
Sequence:CCGGCATTAGGACATGGTCATATTTCTCGAGAAATATGACCATGTCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6812s1c1
Sequence:CCGGGCCATCTCTGTAATCGCACATCTCGAGATGTGCGATTACAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6813s1c1
Sequence:CCGGCCATCTCTGTAATCGCACATTCTCGAGAATGTGCGATTACAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-625s1c1
Sequence:CCGGCCTGGTCATACAGATAGAATACTCGAGTATTCTATCTGTATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-4607s1c1
Sequence:CCGGGCTACCATTCAAAGGGAGTATCTCGAGATACTCCCTTTGAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6791s1c1
Sequence:CCGGGCCATCAGTTTATGTTCAGATCTCGAGATCTGAACATAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183387
EML5 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183387.1-6285s21c1
Sequence:CCGGGCTATATGCACTGGGTATAATCTCGAGATTATACCCAGTGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-1904s21c1
Sequence:CCGGATGATTATCAGTGGGTTATTTCTCGAGAAATAACCCACTGATAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-2245s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-3080s21c1
Sequence:CCGGCATTAGGACATGGTCATATTTCTCGAGAAATATGACCATGTCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6812s1c1
Sequence:CCGGGCCATCTCTGTAATCGCACATCTCGAGATGTGCGATTACAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6813s1c1
Sequence:CCGGCCATCTCTGTAATCGCACATTCTCGAGAATGTGCGATTACAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-625s1c1
Sequence:CCGGCCTGGTCATACAGATAGAATACTCGAGTATTCTATCTGTATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-4607s1c1
Sequence:CCGGGCTACCATTCAAAGGGAGTATCTCGAGATACTCCCTTTGAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6791s1c1
Sequence:CCGGGCCATCAGTTTATGTTCAGATCTCGAGATCTGAACATAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183387
EML5 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183387.1-6285s21c1
Sequence:CCGGGCTATATGCACTGGGTATAATCTCGAGATTATACCCAGTGCATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-1904s21c1
Sequence:CCGGATGATTATCAGTGGGTTATTTCTCGAGAAATAACCCACTGATAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-2245s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183387.1-3080s21c1
Sequence:CCGGCATTAGGACATGGTCATATTTCTCGAGAAATATGACCATGTCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6812s1c1
Sequence:CCGGGCCATCTCTGTAATCGCACATCTCGAGATGTGCGATTACAGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6813s1c1
Sequence:CCGGCCATCTCTGTAATCGCACATTCTCGAGAATGTGCGATTACAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-625s1c1
Sequence:CCGGCCTGGTCATACAGATAGAATACTCGAGTATTCTATCTGTATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183387.1-4607s1c1
Sequence:CCGGGCTACCATTCAAAGGGAGTATCTCGAGATACTCCCTTTGAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183387.1-6791s1c1
Sequence:CCGGGCCATCAGTTTATGTTCAGATCTCGAGATCTGAACATAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081191
EML5 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-1761s21c1
Sequence:CCGGTGGAGTTGCTCAGCGTTATAACTCGAGTTATAACGCTGAGCAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081191.1-6933s21c1
Sequence:CCGGGCAGTACATGGCTACTATATTCTCGAGAATATAGTAGCCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3350s21c1
Sequence:CCGGCATTAGGGCATGGTCATATTTCTCGAGAAATATGACCATGCCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3261s21c1
Sequence:CCGGCCTCAAGACCTATGCTATAAACTCGAGTTTATAGCATAGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-2515s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081191
EML5 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-1761s21c1
Sequence:CCGGTGGAGTTGCTCAGCGTTATAACTCGAGTTATAACGCTGAGCAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081191.1-6933s21c1
Sequence:CCGGGCAGTACATGGCTACTATATTCTCGAGAATATAGTAGCCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3350s21c1
Sequence:CCGGCATTAGGGCATGGTCATATTTCTCGAGAAATATGACCATGCCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3261s21c1
Sequence:CCGGCCTCAAGACCTATGCTATAAACTCGAGTTTATAGCATAGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-2515s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081191
EML5 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-1761s21c1
Sequence:CCGGTGGAGTTGCTCAGCGTTATAACTCGAGTTATAACGCTGAGCAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081191.1-6933s21c1
Sequence:CCGGGCAGTACATGGCTACTATATTCTCGAGAATATAGTAGCCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3350s21c1
Sequence:CCGGCATTAGGGCATGGTCATATTTCTCGAGAAATATGACCATGCCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-3261s21c1
Sequence:CCGGCCTCAAGACCTATGCTATAAACTCGAGTTTATAGCATAGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081191.1-2515s21c1
Sequence:CCGGGGTTATGACTGTCGAAGTAATCTCGAGATTACTTCGACAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks